EMAIL THIS PAGE TO A FRIEND

NUDT19

nudix (nucleoside diphosphate linked moiety X)-type motif 19

57 Gene Product Result for
Synonyms: RP2
UniProtKB ID: A8MXV4
Gene ID:
Mouse(110959) nudix (nucleoside diphosphate linked moiety X)-type motif 19
Rat(308518) nudix (nucleoside diphosphate linked moiety X)-type motif 19
Zebrafish(794545) nudix (nucleoside diphosphate linked moiety X)-type motif 19
cow(785361) nudix (nucleoside diphosphate linked moiety X)-type motif 19
chicken(427548) nudix (nucleoside diphosphate linked moiety X)-type motif 19
domestic cat(101084153) nudix (nucleoside diphosphate linked moiety X)-type motif 19
dog(100683930) nudix (nucleoside diphosphate linked moiety X)-type motif 19
sheep(101109295) nudix (nucleoside diphosphate linked moiety X)-type motif 19
naked mole-rat(101719308) nudix (nucleoside diphosphate linked moiety X)-type motif 19
domestic guinea pig(100731179) nudix (nucleoside diphosphate linked moiety X)-type motif 19
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1301882 ANTI-NUDT19 (CENTER) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
flow cytometry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001105570 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001105570 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001105570 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_033080 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_033080 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_033080 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001105570 Rosetta Predictions human pricing
XM_372723 Rosetta Predictions human pricing
NM_001004258 Rosetta Predictions rat pricing
NM_033080 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105570 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00324501 predicted 727
2 SASI_Hs02_00324502 predicted 891
3 SASI_Hs02_00324503 predicted 921
4 SASI_Hs02_00324504 predicted 272
5 SASI_Hs02_00324505 predicted 888
6 SASI_Hs02_00324506 predicted 281
7 SASI_Hs02_00324507 predicted 1005
8 SASI_Hs02_00324508 predicted 1005
9 SASI_Hs02_00324509 predicted 318
10 SASI_Hs02_00324510 predicted 562
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_372723 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00283833 predicted 1109
2 SASI_Hs01_00283834 predicted 1267
3 SASI_Hs01_00283835 predicted 1302
4 SASI_Hs01_00283836 predicted 655
5 SASI_Hs01_00283837 predicted 655
6 SASI_Hs01_00283838 predicted 1166
7 SASI_Hs01_00283839 predicted 705
8 SASI_Hs01_00283840 predicted 1172
9 SASI_Hs01_00283841 predicted 939
10 SASI_Hs01_00283842 predicted 1278
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001004258 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00105803 predicted 851
2 SASI_Rn01_00105804 predicted 363
3 SASI_Rn01_00105805 predicted 831
4 SASI_Rn01_00105806 predicted 844
5 SASI_Rn02_00198277 predicted 294
6 SASI_Rn01_00105807 predicted 259
7 SASI_Rn01_00105808 predicted 1000
8 SASI_Rn01_00105809 predicted 987
9 SASI_Rn02_00198278 predicted 804
10 SASI_Rn01_00105811 predicted 922
11 SASI_Rn01_00105810 predicted 780
12 SASI_Rn01_00105812 predicted 1088
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033080 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00153759 predicted 1202
2 SASI_Mm01_00153760 predicted 1230
3 SASI_Mm01_00153761 predicted 1285
4 SASI_Mm01_00153762 predicted 1154
5 SASI_Mm01_00153764 predicted 1219
6 SASI_Mm01_00153766 predicted 1248
7 SASI_Mm02_00337287 predicted 1153
8 SASI_Mm01_00153767 predicted 1178
9 SASI_Mm02_00337288 predicted 1182
10 SASI_Mm02_00337289 predicted 1110
11 SASI_Mm01_00153763 predicted 1023
12 SASI_Mm01_00153765 predicted 1103
13 SASI_Mm01_00153768 predicted 981
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001105570
NUDT19 MISSION shRNA Bacterial Glycerol Stock
nudix (nucleoside diphosphate linked moiety X)-type motif 19
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000236669    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001105570.1-1118s21c1
Sequence:CCGGGCCATTTGTAGGGTGCTTAAGCTCGAGCTTAAGCACCCTACAAATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236667    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001105570.1-1029s21c1
Sequence:CCGGGACATACCATCGCCACCTTTACTCGAGTAAAGGTGGCGATGGTATGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236670    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001105570.1-917s21c1
Sequence:CCGGTACCAGGTGATGAGCTATATTCTCGAGAATATAGCTCATCACCTGGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236668    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001105570.1-1071s21c1
Sequence:CCGGGCCAAAGTATAAACACGTTTACTCGAGTAAACGTGTTTATACTTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236666    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001105570.1-1922s21c1
Sequence:CCGGACAGTGTGCCACACGTATAAACTCGAGTTTATACGTGTGGCACACTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001105570
NUDT19 MISSION shRNA shRNA Plasmid DNA
nudix (nucleoside diphosphate linked moiety X)-type motif 19
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000236669    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001105570.1-1118s21c1
Sequence:CCGGGCCATTTGTAGGGTGCTTAAGCTCGAGCTTAAGCACCCTACAAATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000236667    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001105570.1-1029s21c1
Sequence:CCGGGACATACCATCGCCACCTTTACTCGAGTAAAGGTGGCGATGGTATGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000236670    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001105570.1-917s21c1
Sequence:CCGGTACCAGGTGATGAGCTATATTCTCGAGAATATAGCTCATCACCTGGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000236668    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001105570.1-1071s21c1
Sequence:CCGGGCCAAAGTATAAACACGTTTACTCGAGTAAACGTGTTTATACTTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000236666    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001105570.1-1922s21c1
Sequence:CCGGACAGTGTGCCACACGTATAAACTCGAGTTTATACGTGTGGCACACTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001105570
NUDT19 MISSION shRNA Lentiviral Transduction Particles
nudix (nucleoside diphosphate linked moiety X)-type motif 19
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000236669    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001105570.1-1118s21c1
Sequence:CCGGGCCATTTGTAGGGTGCTTAAGCTCGAGCTTAAGCACCCTACAAATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236667    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001105570.1-1029s21c1
Sequence:CCGGGACATACCATCGCCACCTTTACTCGAGTAAAGGTGGCGATGGTATGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236670    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001105570.1-917s21c1
Sequence:CCGGTACCAGGTGATGAGCTATATTCTCGAGAATATAGCTCATCACCTGGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236668    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001105570.1-1071s21c1
Sequence:CCGGGCCAAAGTATAAACACGTTTACTCGAGTAAACGTGTTTATACTTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236666    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001105570.1-1922s21c1
Sequence:CCGGACAGTGTGCCACACGTATAAACTCGAGTTTATACGTGTGGCACACTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033080
VALIDATED
NUDT19 MISSION shRNA Bacterial Glycerol Stock
nudix (nucleoside diphosphate linked moiety X)-type motif 19
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000250018    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_033080.2-925s21c1
Sequence:CCGGTGAGAAATGGCTGCCAATAATCTCGAGATTATTGGCAGCCATTTCTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194128    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033080.1-708s1c1
Sequence:CCGGGAGGCAACTGAATGTTTCCTACTCGAGTAGGAAACATTCAGTTGCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250016    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_033080.2-1155s21c1
Sequence:CCGGCTAGGAACTACATAGTGAATACTCGAGTATTCACTATGTAGTTCCTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250017    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033080.2-1537s21c1
Sequence:CCGGATTCCGAGATACCTAGTTAAACTCGAGTTTAACTAGGTATCTCGGAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250020    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_033080.2-1192s21c1
Sequence:CCGGCCTGTAAGCCGCACTACTTATCTCGAGATAAGTAGTGCGGCTTACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193994    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033080.1-969s1c1
Sequence:CCGGGAAATCGTGAAGGAAGGCAAACTCGAGTTTGCCTTCCTTCACGATTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215342    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033080.2-1155s1c1
Sequence:CCGGCTAGGAACTACATAGTGAATACTCGAGTATTCACTATGTAGTTCCTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250019    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_033080.2-1096s21c1
Sequence:CCGGCAGTCCCTATGTGTACGAAATCTCGAGATTTCGTACACATAGGGACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033080
VALIDATED
NUDT19 MISSION shRNA shRNA Plasmid DNA
nudix (nucleoside diphosphate linked moiety X)-type motif 19
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000250018    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_033080.2-925s21c1
Sequence:CCGGTGAGAAATGGCTGCCAATAATCTCGAGATTATTGGCAGCCATTTCTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194128    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033080.1-708s1c1
Sequence:CCGGGAGGCAACTGAATGTTTCCTACTCGAGTAGGAAACATTCAGTTGCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250016    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_033080.2-1155s21c1
Sequence:CCGGCTAGGAACTACATAGTGAATACTCGAGTATTCACTATGTAGTTCCTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250017    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033080.2-1537s21c1
Sequence:CCGGATTCCGAGATACCTAGTTAAACTCGAGTTTAACTAGGTATCTCGGAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250020    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_033080.2-1192s21c1
Sequence:CCGGCCTGTAAGCCGCACTACTTATCTCGAGATAAGTAGTGCGGCTTACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000193994    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033080.1-969s1c1
Sequence:CCGGGAAATCGTGAAGGAAGGCAAACTCGAGTTTGCCTTCCTTCACGATTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000215342    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033080.2-1155s1c1
Sequence:CCGGCTAGGAACTACATAGTGAATACTCGAGTATTCACTATGTAGTTCCTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250019    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_033080.2-1096s21c1
Sequence:CCGGCAGTCCCTATGTGTACGAAATCTCGAGATTTCGTACACATAGGGACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033080
VALIDATED
NUDT19 MISSION shRNA Lentiviral Transduction Particles
nudix (nucleoside diphosphate linked moiety X)-type motif 19
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000250018    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_033080.2-925s21c1
Sequence:CCGGTGAGAAATGGCTGCCAATAATCTCGAGATTATTGGCAGCCATTTCTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194128    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033080.1-708s1c1
Sequence:CCGGGAGGCAACTGAATGTTTCCTACTCGAGTAGGAAACATTCAGTTGCCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250016    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_033080.2-1155s21c1
Sequence:CCGGCTAGGAACTACATAGTGAATACTCGAGTATTCACTATGTAGTTCCTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250017    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033080.2-1537s21c1
Sequence:CCGGATTCCGAGATACCTAGTTAAACTCGAGTTTAACTAGGTATCTCGGAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250020    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_033080.2-1192s21c1
Sequence:CCGGCCTGTAAGCCGCACTACTTATCTCGAGATAAGTAGTGCGGCTTACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193994    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033080.1-969s1c1
Sequence:CCGGGAAATCGTGAAGGAAGGCAAACTCGAGTTTGCCTTCCTTCACGATTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215342    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033080.2-1155s1c1
Sequence:CCGGCTAGGAACTACATAGTGAATACTCGAGTATTCACTATGTAGTTCCTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250019    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_033080.2-1096s21c1
Sequence:CCGGCAGTCCCTATGTGTACGAAATCTCGAGATTTCGTACACATAGGGACTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)