EMAIL THIS PAGE TO A FRIEND

NUDT1

nudix (nucleoside diphosphate linked moiety X)-type motif 1

118 Gene Product Result for
Synonyms: MTH1
Gene ID:
Human(4521) Summary: Misincorporation of oxidized nucleoside triphosphates into DNA/RNA during replication and transcription can cause mutations that may result in carcinogenesis or neurodegeneration. The protein encoded by this gene is an enzyme that hydrolyzes oxidized purine nucleoside triphosphates, such as 8-oxo-dGTP, 8-oxo-dATP, 2-hydroxy-dATP, and 2-hydroxy rATP, to monophosphates, thereby preventing misincorporation. The encoded protein is localized mainly in the cytoplasm, with some in the mitochondria, suggesting that it is involved in the sanitization of nucleotide pools both for nuclear and mitochondrial genomes. Several alternatively spliced transcript variants, some of which encode distinct isoforms, have been identified. Additional variants have been observed, but their full-length natures have not been determined. A single-nucleotide polymorphism that results in the production of an additional, longer isoform (p26) has been described. [provided by RefSeq, Jul 2008]
Mouse(17766) nudix (nucleoside diphosphate linked moiety X)-type motif 1
Rat(117260) nudix (nucleoside diphosphate linked moiety X)-type motif 1
Zebrafish(406727) nudix (nucleoside diphosphate linked moiety X)-type motif 1
dog(489894) nudix (nucleoside diphosphate linked moiety X)-type motif 1
cow(525496) nudix (nucleoside diphosphate linked moiety X)-type motif 1
domestic cat(101091068) nudix (nucleoside diphosphate linked moiety X)-type motif 1
chicken(416467) nudix (nucleoside diphosphate linked moiety X)-type motif 1
naked mole-rat(101712324) nudix (nucleoside diphosphate linked moiety X)-type motif 1
domestic guinea pig(100730917) nudix (nucleoside diphosphate linked moiety X)-type motif 1
sheep(101119103) nudix (nucleoside diphosphate linked moiety X)-type motif 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008637 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008637 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008637 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002452 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002452 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002452 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002452 Rosetta Predictions human pricing
NM_198948 Rosetta Predictions human pricing
NM_198949 Rosetta Predictions human pricing
NM_198950 Rosetta Predictions human pricing
NM_198952 Rosetta Predictions human pricing
NM_198953 Rosetta Predictions human pricing
NM_198954 Rosetta Predictions human pricing
NM_057120 Rosetta Predictions rat pricing
NM_008637 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002452 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00229629 predicted 389
2 SASI_Hs02_00333856 predicted 353
3 SASI_Hs01_00229630 predicted 432
4 SASI_Hs01_00229631 predicted 269
5 SASI_Hs01_00229632 predicted 339
6 SASI_Hs01_00229633 predicted 285
7 SASI_Hs01_00229634 predicted 275
8 SASI_Hs01_00229635 predicted 277
9 SASI_Hs01_00229636 predicted 405
10 SASI_Hs01_00229637 predicted 385
11 SASI_Hs01_00229638 predicted 415
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198948 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00081224 predicted 448
2 SASI_Hs02_00372456 predicted 404
3 SASI_Hs01_00081225 predicted 490
4 SASI_Hs01_00081226 predicted 315
5 SASI_Hs01_00081227 predicted 388
6 SASI_Hs01_00081228 predicted 334
7 SASI_Hs01_00081229 predicted 329
8 SASI_Hs01_00081230 predicted 328
9 SASI_Hs01_00081231 predicted 449
10 SASI_Hs01_00081232 predicted 433
11 SASI_Hs01_00081233 predicted 463
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198949 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00173676 predicted 517
2 SASI_Hs02_00372457 predicted 475
3 SASI_Hs01_00173677 predicted 555
4 SASI_Hs01_00173678 predicted 389
5 SASI_Hs01_00173679 predicted 462
6 SASI_Hs01_00173680 predicted 413
7 SASI_Hs01_00173681 predicted 403
8 SASI_Hs01_00173682 predicted 399
9 SASI_Hs01_00173683 predicted 525
10 SASI_Hs01_00173684 predicted 504
11 SASI_Hs01_00173685 predicted 533
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198950 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00029158 predicted 441
2 SASI_Hs02_00372458 predicted 394
3 SASI_Hs01_00029159 predicted 480
4 SASI_Hs01_00029160 predicted 314
5 SASI_Hs01_00029161 predicted 379
6 SASI_Hs01_00029162 predicted 332
7 SASI_Hs01_00029163 predicted 321
8 SASI_Hs01_00029164 predicted 330
9 SASI_Hs01_00029165 predicted 449
10 SASI_Hs01_00029166 predicted 437
11 SASI_Hs01_00029167 predicted 455
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198952 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00035315 predicted 514
2 SASI_Hs02_00372465 predicted 473
3 SASI_Hs01_00035316 predicted 556
4 SASI_Hs01_00035317 predicted 388
5 SASI_Hs01_00035318 predicted 456
6 SASI_Hs01_00035319 predicted 409
7 SASI_Hs01_00035320 predicted 391
8 SASI_Hs01_00035321 predicted 402
9 SASI_Hs01_00035322 predicted 521
10 SASI_Hs01_00035323 predicted 505
11 SASI_Hs01_00035324 predicted 534
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198953 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00127977 predicted 434
2 SASI_Hs02_00372466 predicted 381
3 SASI_Hs01_00127978 predicted 475
4 SASI_Hs01_00127979 predicted 306
5 SASI_Hs01_00127980 predicted 369
6 SASI_Hs01_00127981 predicted 326
7 SASI_Hs01_00127982 predicted 308
8 SASI_Hs01_00127983 predicted 312
9 SASI_Hs01_00127984 predicted 437
10 SASI_Hs01_00127985 predicted 419
11 SASI_Hs01_00127986 predicted 449
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198954 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00175506 predicted 503
2 SASI_Hs02_00372467 predicted 458
3 SASI_Hs01_00175507 predicted 539
4 SASI_Hs01_00175508 predicted 375
5 SASI_Hs01_00175509 predicted 445
6 SASI_Hs01_00175510 predicted 399
7 SASI_Hs01_00175511 predicted 388
8 SASI_Hs01_00175512 predicted 391
9 SASI_Hs01_00175513 predicted 509
10 SASI_Hs01_00175514 predicted 489
11 SASI_Hs01_00175515 predicted 514
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_057120 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00064239 predicted 492
2 SASI_Rn01_00064240 predicted 583
3 SASI_Rn01_00064241 predicted 610
4 SASI_Rn01_00064242 predicted 469
5 SASI_Rn01_00064243 predicted 195
6 SASI_Rn01_00064244 predicted 213
7 SASI_Rn01_00064245 predicted 619
8 SASI_Rn01_00064246 predicted 208
9 SASI_Rn01_00064247 predicted 500
10 SASI_Rn01_00064248 predicted 245
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008637 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00123792 predicted 552
2 SASI_Mm02_00314359 predicted 549
3 SASI_Mm01_00123793 predicted 686
4 SASI_Mm01_00123794 predicted 542
5 SASI_Mm01_00123795 predicted 331
6 SASI_Mm01_00123796 predicted 329
7 SASI_Mm01_00123797 predicted 522
8 SASI_Mm01_00123798 predicted 553
9 SASI_Mm01_00123799 predicted 690
10 SASI_Mm01_00123801 predicted 695
11 SASI_Mm01_00123800 predicted 449
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008637
VALIDATED
NUDT1 MISSION shRNA Bacterial Glycerol Stock
nudix (nucleoside diphosphate linked moiety X)-type motif 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000348291    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008637.1-692s21c1
Sequence:CCGGTCACCAATACACCAATGTTTGCTCGAGCAAACATTGGTGTATTGGTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000334269    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008637.1-380s21c1
Sequence:CCGGGCCCACAGAAAGTGAAGAAATCTCGAGATTTCTTCACTTTCTGTGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000334268    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008637.1-279s21c1
Sequence:CCGGGTGGATACACTGCACAAGGTACTCGAGTACCTTGTGCAGTGTATCCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000348292    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008637.1-332s21c1
Sequence:CCGGTGAGCTGATGGACGTGCATATCTCGAGATATGCACGTCCATCAGCTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000334270    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008637.1-488s21c1
Sequence:CCGGGAAGAAGTTCTGTGGGCACTTCTCGAGAAGTGCCCACAGAACTTCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080952    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008637.1-449s1c1
Sequence:CCGGGCCGGATGACAGCTACTGGTTCTCGAGAACCAGTAGCTGTCATCCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080948    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008637.1-679s1c1
Sequence:CCGGGAAATGTGAAATGTCACCAATCTCGAGATTGGTGACATTTCACATTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080949    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008637.1-380s1c1
Sequence:CCGGGCCCACAGAAAGTGAAGAAATCTCGAGATTTCTTCACTTTCTGTGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080950    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008637.1-488s1c1
Sequence:CCGGGAAGAAGTTCTGTGGGCACTTCTCGAGAAGTGCCCACAGAACTTCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080951    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008637.1-279s1c1
Sequence:CCGGGTGGATACACTGCACAAGGTACTCGAGTACCTTGTGCAGTGTATCCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008637
VALIDATED
NUDT1 MISSION shRNA shRNA Plasmid DNA
nudix (nucleoside diphosphate linked moiety X)-type motif 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000348291    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008637.1-692s21c1
Sequence:CCGGTCACCAATACACCAATGTTTGCTCGAGCAAACATTGGTGTATTGGTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000334269    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008637.1-380s21c1
Sequence:CCGGGCCCACAGAAAGTGAAGAAATCTCGAGATTTCTTCACTTTCTGTGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000334268    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008637.1-279s21c1
Sequence:CCGGGTGGATACACTGCACAAGGTACTCGAGTACCTTGTGCAGTGTATCCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000348292    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008637.1-332s21c1
Sequence:CCGGTGAGCTGATGGACGTGCATATCTCGAGATATGCACGTCCATCAGCTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000334270    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008637.1-488s21c1
Sequence:CCGGGAAGAAGTTCTGTGGGCACTTCTCGAGAAGTGCCCACAGAACTTCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080952    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008637.1-449s1c1
Sequence:CCGGGCCGGATGACAGCTACTGGTTCTCGAGAACCAGTAGCTGTCATCCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080948    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008637.1-679s1c1
Sequence:CCGGGAAATGTGAAATGTCACCAATCTCGAGATTGGTGACATTTCACATTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080949    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008637.1-380s1c1
Sequence:CCGGGCCCACAGAAAGTGAAGAAATCTCGAGATTTCTTCACTTTCTGTGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080950    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008637.1-488s1c1
Sequence:CCGGGAAGAAGTTCTGTGGGCACTTCTCGAGAAGTGCCCACAGAACTTCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080951    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008637.1-279s1c1
Sequence:CCGGGTGGATACACTGCACAAGGTACTCGAGTACCTTGTGCAGTGTATCCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008637
VALIDATED
NUDT1 MISSION shRNA Lentiviral Transduction Particles
nudix (nucleoside diphosphate linked moiety X)-type motif 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000348291    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008637.1-692s21c1
Sequence:CCGGTCACCAATACACCAATGTTTGCTCGAGCAAACATTGGTGTATTGGTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000334269    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008637.1-380s21c1
Sequence:CCGGGCCCACAGAAAGTGAAGAAATCTCGAGATTTCTTCACTTTCTGTGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000334268    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008637.1-279s21c1
Sequence:CCGGGTGGATACACTGCACAAGGTACTCGAGTACCTTGTGCAGTGTATCCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000348292    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008637.1-332s21c1
Sequence:CCGGTGAGCTGATGGACGTGCATATCTCGAGATATGCACGTCCATCAGCTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000334270    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008637.1-488s21c1
Sequence:CCGGGAAGAAGTTCTGTGGGCACTTCTCGAGAAGTGCCCACAGAACTTCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080952    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008637.1-449s1c1
Sequence:CCGGGCCGGATGACAGCTACTGGTTCTCGAGAACCAGTAGCTGTCATCCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080948    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008637.1-679s1c1
Sequence:CCGGGAAATGTGAAATGTCACCAATCTCGAGATTGGTGACATTTCACATTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080949    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008637.1-380s1c1
Sequence:CCGGGCCCACAGAAAGTGAAGAAATCTCGAGATTTCTTCACTTTCTGTGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080950    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008637.1-488s1c1
Sequence:CCGGGAAGAAGTTCTGTGGGCACTTCTCGAGAAGTGCCCACAGAACTTCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080951    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008637.1-279s1c1
Sequence:CCGGGTGGATACACTGCACAAGGTACTCGAGTACCTTGTGCAGTGTATCCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002452
VALIDATED
NUDT1 MISSION shRNA Bacterial Glycerol Stock
nudix (nucleoside diphosphate linked moiety X)-type motif 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000288947    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002452.3-279s21c1
Sequence:CCGGCCTGAGCTCATGGACGTGCATCTCGAGATGCACGTCCATGAGCTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288945    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002452.3-425s21c1
Sequence:CCGGCCTGCTTCAGAAGAAGAAATTCTCGAGAATTTCTTCTTCTGAAGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050130    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_002452.3-399s1c1
Sequence:CCGGCCCGACGACAGCTACTGGTTTCTCGAGAAACCAGTAGCTGTCGTCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288946    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002452.3-399s21c1
Sequence:CCGGCCCGACGACAGCTACTGGTTTCTCGAGAAACCAGTAGCTGTCGTCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306995    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002452.3-96s21c1
Sequence:CCGGCGAGTTCTCCTGGGCATGAAACTCGAGTTTCATGCCCAGGAGAACTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050132    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_002452.3-96s1c1
Sequence:CCGGCGAGTTCTCCTGGGCATGAAACTCGAGTTTCATGCCCAGGAGAACTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050131    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_002452.3-279s1c1
Sequence:CCGGCCTGAGCTCATGGACGTGCATCTCGAGATGCACGTCCATGAGCTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050129    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_002452.3-425s1c1
Sequence:CCGGCCTGCTTCAGAAGAAGAAATTCTCGAGAATTTCTTCTTCTGAAGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002452
VALIDATED
NUDT1 MISSION shRNA shRNA Plasmid DNA
nudix (nucleoside diphosphate linked moiety X)-type motif 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000288947    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002452.3-279s21c1
Sequence:CCGGCCTGAGCTCATGGACGTGCATCTCGAGATGCACGTCCATGAGCTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000288945    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002452.3-425s21c1
Sequence:CCGGCCTGCTTCAGAAGAAGAAATTCTCGAGAATTTCTTCTTCTGAAGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050130    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_002452.3-399s1c1
Sequence:CCGGCCCGACGACAGCTACTGGTTTCTCGAGAAACCAGTAGCTGTCGTCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000288946    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002452.3-399s21c1
Sequence:CCGGCCCGACGACAGCTACTGGTTTCTCGAGAAACCAGTAGCTGTCGTCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000306995    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002452.3-96s21c1
Sequence:CCGGCGAGTTCTCCTGGGCATGAAACTCGAGTTTCATGCCCAGGAGAACTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050132    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_002452.3-96s1c1
Sequence:CCGGCGAGTTCTCCTGGGCATGAAACTCGAGTTTCATGCCCAGGAGAACTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050131    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_002452.3-279s1c1
Sequence:CCGGCCTGAGCTCATGGACGTGCATCTCGAGATGCACGTCCATGAGCTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050129    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_002452.3-425s1c1
Sequence:CCGGCCTGCTTCAGAAGAAGAAATTCTCGAGAATTTCTTCTTCTGAAGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002452
VALIDATED
NUDT1 MISSION shRNA Lentiviral Transduction Particles
nudix (nucleoside diphosphate linked moiety X)-type motif 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000288947    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002452.3-279s21c1
Sequence:CCGGCCTGAGCTCATGGACGTGCATCTCGAGATGCACGTCCATGAGCTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288945    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002452.3-425s21c1
Sequence:CCGGCCTGCTTCAGAAGAAGAAATTCTCGAGAATTTCTTCTTCTGAAGCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050130    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_002452.3-399s1c1
Sequence:CCGGCCCGACGACAGCTACTGGTTTCTCGAGAAACCAGTAGCTGTCGTCGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288946    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002452.3-399s21c1
Sequence:CCGGCCCGACGACAGCTACTGGTTTCTCGAGAAACCAGTAGCTGTCGTCGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306995    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002452.3-96s21c1
Sequence:CCGGCGAGTTCTCCTGGGCATGAAACTCGAGTTTCATGCCCAGGAGAACTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050132    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_002452.3-96s1c1
Sequence:CCGGCGAGTTCTCCTGGGCATGAAACTCGAGTTTCATGCCCAGGAGAACTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050131    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_002452.3-279s1c1
Sequence:CCGGCCTGAGCTCATGGACGTGCATCTCGAGATGCACGTCCATGAGCTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050129    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_002452.3-425s1c1
Sequence:CCGGCCTGCTTCAGAAGAAGAAATTCTCGAGAATTTCTTCTTCTGAAGCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)