EMAIL THIS PAGE TO A FRIEND

NUDT21

nudix (nucleoside diphosphate linked moiety X)-type motif 21

136 Gene Product Result for
Synonyms: CFIM25 CPSF5
UniProtKB ID: O43809, Q6IB85, Q6NE84
Gene ID:
Human(11051) Summary: The protein encoded by this gene is one subunit of a cleavage factor required for 3' RNA cleavage and polyadenylation processing. The interaction of the protein with the RNA is one of the earliest steps in the assembly of the 3' end processing complex and facilitates the recruitment of other processing factors. This gene encodes the 25kD subunit of the protein complex, which is composed of four polypeptides. [provided by RefSeq, Jul 2008]
Mouse(68219) nudix (nucleoside diphosphate linked moiety X)-type motif 21
Rat(291877) nudix (nucleoside diphosphate linked moiety X)-type motif 21
Thale Cress(843688) nudix hydrolase 21
cow(518859) nudix (nucleoside diphosphate linked moiety X)-type motif 21
domestic cat(101101604) nudix (nucleoside diphosphate linked moiety X)-type motif 21
dog(478123) nudix (nucleoside diphosphate linked moiety X)-type motif 21
chicken(100858636) nudix (nucleoside diphosphate linked moiety X)-type motif 21
sheep(101119240) nudix (nucleoside diphosphate linked moiety X)-type motif 21
naked mole-rat(101720985) nudix (nucleoside diphosphate linked moiety X)-type motif 21
domestic guinea pig(100729094) nudix (nucleoside diphosphate linked moiety X)-type motif 21
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007006 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_007006 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_007006 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026623 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026623 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026623 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_007006 Rosetta Predictions human pricing
NM_001039004 Rosetta Predictions rat pricing
NM_026623 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007006 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00146873 predicted 574
2 SASI_Hs01_00146875 predicted 260
3 SASI_Hs01_00146876 predicted 334
4 SASI_Hs01_00146877 predicted 875
5 SASI_Hs01_00146878 predicted 660
6 SASI_Hs01_00146879 predicted 318
7 SASI_Hs01_00146880 predicted 517
8 SASI_Hs01_00146881 predicted 873
9 SASI_Hs02_00342761 predicted 201
10 SASI_Hs02_00342762 predicted 649
11 SASI_Hs01_00146872 predicted 763
12 SASI_Hs01_00146874 predicted 618
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039004 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00087601 predicted 194
2 SASI_Rn01_00087602 predicted 695
3 SASI_Rn01_00087603 predicted 660
4 SASI_Rn01_00087604 predicted 388
5 SASI_Rn01_00087605 predicted 548
6 SASI_Rn01_00087606 predicted 669
7 SASI_Rn01_00087607 predicted 374
8 SASI_Rn02_00204726 predicted 194
9 SASI_Rn01_00087608 predicted 584
10 SASI_Rn01_00087609 predicted 449
11 SASI_Rn01_00087610 predicted 577
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026623 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00041664 predicted 258
2 SASI_Mm02_00330587 predicted 249
3 SASI_Mm01_00041669 predicted 259
4 SASI_Mm02_00330588 predicted 621
5 SASI_Mm02_00330589 predicted 692
6 SASI_Mm02_00330590 predicted 342
7 SASI_Mm01_00041671 predicted 546
8 SASI_Mm02_00330591 predicted 205
9 SASI_Mm01_00041673 predicted 444
10 SASI_Mm02_00330592 predicted 734
11 SASI_Mm01_00041665 predicted 1261
12 SASI_Mm01_00041666 predicted 223
13 SASI_Mm01_00041667 predicted 610
14 SASI_Mm01_00041668 predicted 1270
15 SASI_Mm01_00041670 predicted 280
16 SASI_Mm01_00041672 predicted 273
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007006
VALIDATED
NUDT21 MISSION shRNA Bacterial Glycerol Stock
nudix (nucleoside diphosphate linked moiety X)-type motif 21
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000000149    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_007006.x-460s1c1
Sequence:CCGGGAACCTCCTCAGTATCCATATCTCGAGATATGGATACTGAGGAGGTTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000272636    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_007006.2-764s21c1
Sequence:CCGGCAGGATATGGACCCATCATTTCTCGAGAAATGATGGGTCCATATCCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000145    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_007006.x-743s1c1
Sequence:CCGGCAGTGTAGAATAAATGTGGTACTCGAGTACCACATTTATTCTACACTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000146    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007006.x-485s1c1
Sequence:CCGGCTGCACATATTACAAAGCCTACTCGAGTAGGCTTTGTAATATGTGCAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000148    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_007006.x-193s1c1
Sequence:CCGGCAGCGCATGAGGGAAGAATTTCTCGAGAAATTCTTCCCTCATGCGCTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000147    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007006.x-420s1c1
Sequence:CCGGCATTGACGATTGCATTGGTAACTCGAGTTACCAATGCAATCGTCAATGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000272630    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_007006.2-263s21c1
Sequence:CCGGTGTACCCTCTTACCAATTATACTCGAGTATAATTGGTAAGAGGGTACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000272572    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_007006.2-890s21c1
Sequence:CCGGCAGTGTAGAATAAATGTGGTACTCGAGTACCACATTTATTCTACACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000272573    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_007006.2-462s21c1
Sequence:CCGGACTACCTGGTGGTGAACTTAACTCGAGTTAAGTTCACCACCAGGTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000272629    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_007006.2-607s21c1
Sequence:CCGGGAACCTCCTCAGTATCCATATCTCGAGATATGGATACTGAGGAGGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007006
VALIDATED
NUDT21 MISSION shRNA shRNA Plasmid DNA
nudix (nucleoside diphosphate linked moiety X)-type motif 21
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000000149    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_007006.x-460s1c1
Sequence:CCGGGAACCTCCTCAGTATCCATATCTCGAGATATGGATACTGAGGAGGTTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000272636    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_007006.2-764s21c1
Sequence:CCGGCAGGATATGGACCCATCATTTCTCGAGAAATGATGGGTCCATATCCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000145    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_007006.x-743s1c1
Sequence:CCGGCAGTGTAGAATAAATGTGGTACTCGAGTACCACATTTATTCTACACTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000146    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007006.x-485s1c1
Sequence:CCGGCTGCACATATTACAAAGCCTACTCGAGTAGGCTTTGTAATATGTGCAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000148    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_007006.x-193s1c1
Sequence:CCGGCAGCGCATGAGGGAAGAATTTCTCGAGAAATTCTTCCCTCATGCGCTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000147    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007006.x-420s1c1
Sequence:CCGGCATTGACGATTGCATTGGTAACTCGAGTTACCAATGCAATCGTCAATGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000272630    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_007006.2-263s21c1
Sequence:CCGGTGTACCCTCTTACCAATTATACTCGAGTATAATTGGTAAGAGGGTACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000272572    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_007006.2-890s21c1
Sequence:CCGGCAGTGTAGAATAAATGTGGTACTCGAGTACCACATTTATTCTACACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000272573    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_007006.2-462s21c1
Sequence:CCGGACTACCTGGTGGTGAACTTAACTCGAGTTAAGTTCACCACCAGGTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000272629    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_007006.2-607s21c1
Sequence:CCGGGAACCTCCTCAGTATCCATATCTCGAGATATGGATACTGAGGAGGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007006
VALIDATED
NUDT21 MISSION shRNA Lentiviral Transduction Particles
nudix (nucleoside diphosphate linked moiety X)-type motif 21
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000000149    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_007006.x-460s1c1
Sequence:CCGGGAACCTCCTCAGTATCCATATCTCGAGATATGGATACTGAGGAGGTTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000272636    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_007006.2-764s21c1
Sequence:CCGGCAGGATATGGACCCATCATTTCTCGAGAAATGATGGGTCCATATCCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000145    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_007006.x-743s1c1
Sequence:CCGGCAGTGTAGAATAAATGTGGTACTCGAGTACCACATTTATTCTACACTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000146    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007006.x-485s1c1
Sequence:CCGGCTGCACATATTACAAAGCCTACTCGAGTAGGCTTTGTAATATGTGCAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000148    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_007006.x-193s1c1
Sequence:CCGGCAGCGCATGAGGGAAGAATTTCTCGAGAAATTCTTCCCTCATGCGCTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000147    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007006.x-420s1c1
Sequence:CCGGCATTGACGATTGCATTGGTAACTCGAGTTACCAATGCAATCGTCAATGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000272630    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_007006.2-263s21c1
Sequence:CCGGTGTACCCTCTTACCAATTATACTCGAGTATAATTGGTAAGAGGGTACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000272572    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_007006.2-890s21c1
Sequence:CCGGCAGTGTAGAATAAATGTGGTACTCGAGTACCACATTTATTCTACACTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000272573    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_007006.2-462s21c1
Sequence:CCGGACTACCTGGTGGTGAACTTAACTCGAGTTAAGTTCACCACCAGGTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000272629    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_007006.2-607s21c1
Sequence:CCGGGAACCTCCTCAGTATCCATATCTCGAGATATGGATACTGAGGAGGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026623
VALIDATED
NUDT21 MISSION shRNA Bacterial Glycerol Stock
nudix (nucleoside diphosphate linked moiety X)-type motif 21
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000109255    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026623.2-818s1c1
Sequence:CCGGCGTCTCTATGAGCACAGCTTACTCGAGTAAGCTGTGCTCATAGAGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109256    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026623.2-692s1c1
Sequence:CCGGGCACCATTGTTTGAGCTGTATCTCGAGATACAGCTCAAACAATGGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109257    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026623.2-226s1c1
Sequence:CCGGCCCGCTTACCAATTATACTTTCTCGAGAAAGTATAATTGGTAAGCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109258    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026623.2-569s1c1
Sequence:CCGGCCTCCTCAGTATCCGTATATTCTCGAGAATATACGGATACTGAGGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109259    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026623.2-757s1c1
Sequence:CCGGGCTGCTGAGCAGGTTCAATTTCTCGAGAAATTGAACCTGCTCAGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327085    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026623.3-610s21c1
Sequence:CCGGCCTCCTCAGTATCCGTATATTCTCGAGAATATACGGATACTGAGGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327154    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026623.3-859s21c1
Sequence:CCGGCGTCTCTATGAGCACAGCTTACTCGAGTAAGCTGTGCTCATAGAGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327155    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026623.3-798s21c1
Sequence:CCGGGCTGCTGAGCAGGTTCAATTTCTCGAGAAATTGAACCTGCTCAGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327083    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026623.3-733s21c1
Sequence:CCGGGCACCATTGTTTGAGCTGTATCTCGAGATACAGCTCAAACAATGGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327157    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026623.3-267s21c1
Sequence:CCGGCCCGCTTACCAATTATACTTTCTCGAGAAAGTATAATTGGTAAGCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026623
VALIDATED
NUDT21 MISSION shRNA shRNA Plasmid DNA
nudix (nucleoside diphosphate linked moiety X)-type motif 21
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000109255    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026623.2-818s1c1
Sequence:CCGGCGTCTCTATGAGCACAGCTTACTCGAGTAAGCTGTGCTCATAGAGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000109256    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026623.2-692s1c1
Sequence:CCGGGCACCATTGTTTGAGCTGTATCTCGAGATACAGCTCAAACAATGGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000109257    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026623.2-226s1c1
Sequence:CCGGCCCGCTTACCAATTATACTTTCTCGAGAAAGTATAATTGGTAAGCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000109258    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026623.2-569s1c1
Sequence:CCGGCCTCCTCAGTATCCGTATATTCTCGAGAATATACGGATACTGAGGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000109259    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026623.2-757s1c1
Sequence:CCGGGCTGCTGAGCAGGTTCAATTTCTCGAGAAATTGAACCTGCTCAGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000327085    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026623.3-610s21c1
Sequence:CCGGCCTCCTCAGTATCCGTATATTCTCGAGAATATACGGATACTGAGGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000327154    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026623.3-859s21c1
Sequence:CCGGCGTCTCTATGAGCACAGCTTACTCGAGTAAGCTGTGCTCATAGAGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000327155    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026623.3-798s21c1
Sequence:CCGGGCTGCTGAGCAGGTTCAATTTCTCGAGAAATTGAACCTGCTCAGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000327083    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026623.3-733s21c1
Sequence:CCGGGCACCATTGTTTGAGCTGTATCTCGAGATACAGCTCAAACAATGGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000327157    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026623.3-267s21c1
Sequence:CCGGCCCGCTTACCAATTATACTTTCTCGAGAAAGTATAATTGGTAAGCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026623
VALIDATED
NUDT21 MISSION shRNA Lentiviral Transduction Particles
nudix (nucleoside diphosphate linked moiety X)-type motif 21
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000109255    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026623.2-818s1c1
Sequence:CCGGCGTCTCTATGAGCACAGCTTACTCGAGTAAGCTGTGCTCATAGAGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109256    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026623.2-692s1c1
Sequence:CCGGGCACCATTGTTTGAGCTGTATCTCGAGATACAGCTCAAACAATGGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109257    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026623.2-226s1c1
Sequence:CCGGCCCGCTTACCAATTATACTTTCTCGAGAAAGTATAATTGGTAAGCGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109258    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026623.2-569s1c1
Sequence:CCGGCCTCCTCAGTATCCGTATATTCTCGAGAATATACGGATACTGAGGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109259    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026623.2-757s1c1
Sequence:CCGGGCTGCTGAGCAGGTTCAATTTCTCGAGAAATTGAACCTGCTCAGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327085    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026623.3-610s21c1
Sequence:CCGGCCTCCTCAGTATCCGTATATTCTCGAGAATATACGGATACTGAGGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327154    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026623.3-859s21c1
Sequence:CCGGCGTCTCTATGAGCACAGCTTACTCGAGTAAGCTGTGCTCATAGAGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327155    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026623.3-798s21c1
Sequence:CCGGGCTGCTGAGCAGGTTCAATTTCTCGAGAAATTGAACCTGCTCAGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327083    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026623.3-733s21c1
Sequence:CCGGGCACCATTGTTTGAGCTGTATCTCGAGATACAGCTCAAACAATGGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327157    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026623.3-267s21c1
Sequence:CCGGCCCGCTTACCAATTATACTTTCTCGAGAAAGTATAATTGGTAAGCGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)