EMAIL THIS PAGE TO A FRIEND

NUDT3

nudix (nucleoside diphosphate linked moiety X)-type motif 3

91 Gene Product Result for
Synonyms: DIPP DIPP-1 DIPP1
UniProtKB ID: O95989, B2R8N4
Gene ID:
Human(11165) Summary: NUDT3 belongs to the MutT, or Nudix, protein family. Nudix proteins act as homeostatic checkpoints at important stages in nucleoside phosphate metabolic pathways, guarding against elevated levels of potentially dangerous intermediates, like 8-oxo-dGTP, which promotes AT-to-CG transversions (Safrany et al., 1998 [PubMed 9822604]
Mouse(56409) nudix (nucleotide diphosphate linked moiety X)-type motif 3
Rat(294292) nudix (nucleoside diphosphate linked moiety X)-type motif 3
Thale Cress(844308) nudix hydrolase 3
chicken(419905) nudix (nucleoside diphosphate linked moiety X)-type motif 3
dog(100846983) nudix (nucleoside diphosphate linked moiety X)-type motif 3
cow(618855) nudix (nucleoside diphosphate linked moiety X)-type motif 3
domestic cat(101088487) nudix (nucleoside diphosphate linked moiety X)-type motif 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006703 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006703 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006703 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_019837 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019837 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019837 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006703 Rosetta Predictions human pricing
NM_001024243 Rosetta Predictions rat pricing
NM_019837 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006703 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00028961 predicted 571
2 SASI_Hs01_00028962 predicted 330
3 SASI_Hs01_00028963 predicted 944
4 SASI_Hs01_00028965 predicted 758
5 SASI_Hs01_00028966 predicted 802
6 SASI_Hs01_00028967 predicted 618
7 SASI_Hs01_00028968 predicted 560
8 SASI_Hs01_00028969 predicted 725
9 SASI_Hs01_00028970 predicted 946
10 SASI_Hs02_00342128 predicted 849
11 SASI_Hs01_00028964 predicted 927
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024243 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00035331 predicted 462
2 SASI_Rn01_00035332 predicted 434
3 SASI_Rn01_00035333 predicted 425
4 SASI_Rn01_00035335 predicted 473
5 SASI_Rn01_00035334 predicted 427
6 SASI_Rn01_00035336 predicted 230
7 SASI_Rn01_00035337 predicted 1136
8 SASI_Rn01_00035339 predicted 1143
9 SASI_Rn01_00035340 predicted 631
10 SASI_Rn02_00202393 predicted 1134
11 SASI_Rn01_00035338 predicted 1070
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019837 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00033935 predicted 538
2 SASI_Mm01_00033936 predicted 489
3 SASI_Mm02_00325147 predicted 489
4 SASI_Mm01_00033937 predicted 639
5 SASI_Mm01_00033938 predicted 761
6 SASI_Mm01_00033939 predicted 673
7 SASI_Mm02_00325148 predicted 668
8 SASI_Mm01_00033940 predicted 481
9 SASI_Mm01_00033941 predicted 453
10 SASI_Mm01_00033942 predicted 795
11 SASI_Mm01_00033933 predicted 297
12 SASI_Mm01_00033934 predicted 385
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006703
VALIDATED
NUDT3 MISSION shRNA Bacterial Glycerol Stock
nudix (nucleoside diphosphate linked moiety X)-type motif 3
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000050583    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_006703.2-532s1c1
Sequence:CCGGTGGGAAGATTAGTTGGAATTTCTCGAGAAATTCCAACTAATCTTCCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050584    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_006703.2-722s1c1
Sequence:CCGGTGAAACATTGAGGCAAGGCTACTCGAGTAGCCTTGCCTCAATGTTTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050586    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006703.2-799s1c1
Sequence:CCGGGCTCGATGTCAGGCATCAGATCTCGAGATCTGATGCCTGACATCGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050585    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_006703.2-578s1c1
Sequence:CCGGGACGTATGTCTATGTGCTCATCTCGAGATGAGCACATAGACATACGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000382242    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_006703.2-1134s21c1
Sequence:GTACCGGAGTGTTCCTGTTTGTCTTATCCTCGAGGATAAGACAAACAGGAACACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000331660    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_006703.2-799s21c1
Sequence:CCGGGCTCGATGTCAGGCATCAGATCTCGAGATCTGATGCCTGACATCGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299420    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006703.2-578s21c1
Sequence:CCGGGACGTATGTCTATGTGCTCATCTCGAGATGAGCACATAGACATACGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299498    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006703.2-722s21c1
Sequence:CCGGTGAAACATTGAGGCAAGGCTACTCGAGTAGCCTTGCCTCAATGTTTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299497    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_006703.2-532s21c1
Sequence:CCGGTGGGAAGATTAGTTGGAATTTCTCGAGAAATTCCAACTAATCTTCCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381064    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_006703.2-907s21c1
Sequence:GTACCGGCACAGGCCTCCTCTTTCAAATCTCGAGATTTGAAAGAGGAGGCCTGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380738    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_006703.2-965s21c1
Sequence:GTACCGGATGTTGCTGTTTGGTGTTAAGCTCGAGCTTAACACCAAACAGCAACATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006703
VALIDATED
NUDT3 MISSION shRNA shRNA Plasmid DNA
nudix (nucleoside diphosphate linked moiety X)-type motif 3
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000050583    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_006703.2-532s1c1
Sequence:CCGGTGGGAAGATTAGTTGGAATTTCTCGAGAAATTCCAACTAATCTTCCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050584    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_006703.2-722s1c1
Sequence:CCGGTGAAACATTGAGGCAAGGCTACTCGAGTAGCCTTGCCTCAATGTTTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050586    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006703.2-799s1c1
Sequence:CCGGGCTCGATGTCAGGCATCAGATCTCGAGATCTGATGCCTGACATCGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050585    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_006703.2-578s1c1
Sequence:CCGGGACGTATGTCTATGTGCTCATCTCGAGATGAGCACATAGACATACGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000382242    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_006703.2-1134s21c1
Sequence:GTACCGGAGTGTTCCTGTTTGTCTTATCCTCGAGGATAAGACAAACAGGAACACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000331660    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_006703.2-799s21c1
Sequence:CCGGGCTCGATGTCAGGCATCAGATCTCGAGATCTGATGCCTGACATCGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000299420    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006703.2-578s21c1
Sequence:CCGGGACGTATGTCTATGTGCTCATCTCGAGATGAGCACATAGACATACGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000299498    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006703.2-722s21c1
Sequence:CCGGTGAAACATTGAGGCAAGGCTACTCGAGTAGCCTTGCCTCAATGTTTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000299497    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_006703.2-532s21c1
Sequence:CCGGTGGGAAGATTAGTTGGAATTTCTCGAGAAATTCCAACTAATCTTCCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000381064    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_006703.2-907s21c1
Sequence:GTACCGGCACAGGCCTCCTCTTTCAAATCTCGAGATTTGAAAGAGGAGGCCTGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000380738    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_006703.2-965s21c1
Sequence:GTACCGGATGTTGCTGTTTGGTGTTAAGCTCGAGCTTAACACCAAACAGCAACATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006703
VALIDATED
NUDT3 MISSION shRNA Lentiviral Transduction Particles
nudix (nucleoside diphosphate linked moiety X)-type motif 3
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000050583    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_006703.2-532s1c1
Sequence:CCGGTGGGAAGATTAGTTGGAATTTCTCGAGAAATTCCAACTAATCTTCCCATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000050584    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_006703.2-722s1c1
Sequence:CCGGTGAAACATTGAGGCAAGGCTACTCGAGTAGCCTTGCCTCAATGTTTCATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000050586    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006703.2-799s1c1
Sequence:CCGGGCTCGATGTCAGGCATCAGATCTCGAGATCTGATGCCTGACATCGAGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000050585    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_006703.2-578s1c1
Sequence:CCGGGACGTATGTCTATGTGCTCATCTCGAGATGAGCACATAGACATACGTCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000382242    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_006703.2-1134s21c1
Sequence:GTACCGGAGTGTTCCTGTTTGTCTTATCCTCGAGGATAAGACAAACAGGAACACTTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000331660    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_006703.2-799s21c1
Sequence:CCGGGCTCGATGTCAGGCATCAGATCTCGAGATCTGATGCCTGACATCGAGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000299420    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006703.2-578s21c1
Sequence:CCGGGACGTATGTCTATGTGCTCATCTCGAGATGAGCACATAGACATACGTCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000299498    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006703.2-722s21c1
Sequence:CCGGTGAAACATTGAGGCAAGGCTACTCGAGTAGCCTTGCCTCAATGTTTCATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000299497    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_006703.2-532s21c1
Sequence:CCGGTGGGAAGATTAGTTGGAATTTCTCGAGAAATTCCAACTAATCTTCCCATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000381064    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_006703.2-907s21c1
Sequence:GTACCGGCACAGGCCTCCTCTTTCAAATCTCGAGATTTGAAAGAGGAGGCCTGTGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000380738    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_006703.2-965s21c1
Sequence:GTACCGGATGTTGCTGTTTGGTGTTAAGCTCGAGCTTAACACCAAACAGCAACATTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019837
VALIDATED
NUDT3 MISSION shRNA Bacterial Glycerol Stock
nudix (nucleoside diphosphate linked moiety X)-type motif 3
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000334608    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019837.2-497s21c3
Sequence:CCGGTGGGAAGACTAGTTGGAATTTCTCGAGAAATTCCAACTAGTCTTCCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080626    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019837.1-496s1c1
Sequence:CCGGTGGGAAGACTAGTTGGAATTTCTCGAGAAATTCCAACTAGTCTTCCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080624    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019837.1-387s1c1
Sequence:CCGGCGCCATCCAGACCGATGGATTCTCGAGAATCCATCGGTCTGGATGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080625    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019837.1-542s1c1
Sequence:CCGGGACCTACGTGTATGTGCTCATCTCGAGATGAGCACATACACGTAGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080627    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019837.1-676s1c1
Sequence:CCGGCGTCATACTTTGAGACGTTGACTCGAGTCAACGTCTCAAAGTATGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080623    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019837.1-1101s1c1
Sequence:CCGGGCCAGATATTTCCTCTGAATTCTCGAGAATTCAGAGGAAATATCTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000334528    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019837.2-543s21c2
Sequence:CCGGGACCTACGTGTATGTGCTCATCTCGAGATGAGCACATACACGTAGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000351478    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019837.2-677s21c4
Sequence:CCGGCGTCATACTTTGAGACGTTGACTCGAGTCAACGTCTCAAAGTATGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000334578    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019837.2-388s21c2
Sequence:CCGGCGCCATCCAGACCGATGGATTCTCGAGAATCCATCGGTCTGGATGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019837
VALIDATED
NUDT3 MISSION shRNA shRNA Plasmid DNA
nudix (nucleoside diphosphate linked moiety X)-type motif 3
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000334608    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019837.2-497s21c3
Sequence:CCGGTGGGAAGACTAGTTGGAATTTCTCGAGAAATTCCAACTAGTCTTCCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080626    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019837.1-496s1c1
Sequence:CCGGTGGGAAGACTAGTTGGAATTTCTCGAGAAATTCCAACTAGTCTTCCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080624    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019837.1-387s1c1
Sequence:CCGGCGCCATCCAGACCGATGGATTCTCGAGAATCCATCGGTCTGGATGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080625    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019837.1-542s1c1
Sequence:CCGGGACCTACGTGTATGTGCTCATCTCGAGATGAGCACATACACGTAGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080627    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019837.1-676s1c1
Sequence:CCGGCGTCATACTTTGAGACGTTGACTCGAGTCAACGTCTCAAAGTATGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080623    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019837.1-1101s1c1
Sequence:CCGGGCCAGATATTTCCTCTGAATTCTCGAGAATTCAGAGGAAATATCTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000334528    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019837.2-543s21c2
Sequence:CCGGGACCTACGTGTATGTGCTCATCTCGAGATGAGCACATACACGTAGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000351478    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019837.2-677s21c4
Sequence:CCGGCGTCATACTTTGAGACGTTGACTCGAGTCAACGTCTCAAAGTATGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000334578    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019837.2-388s21c2
Sequence:CCGGCGCCATCCAGACCGATGGATTCTCGAGAATCCATCGGTCTGGATGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019837
VALIDATED
NUDT3 MISSION shRNA Lentiviral Transduction Particles
nudix (nucleoside diphosphate linked moiety X)-type motif 3
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000334608    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019837.2-497s21c3
Sequence:CCGGTGGGAAGACTAGTTGGAATTTCTCGAGAAATTCCAACTAGTCTTCCCATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000080626    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019837.1-496s1c1
Sequence:CCGGTGGGAAGACTAGTTGGAATTTCTCGAGAAATTCCAACTAGTCTTCCCATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000080624    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019837.1-387s1c1
Sequence:CCGGCGCCATCCAGACCGATGGATTCTCGAGAATCCATCGGTCTGGATGGCGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000080625    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019837.1-542s1c1
Sequence:CCGGGACCTACGTGTATGTGCTCATCTCGAGATGAGCACATACACGTAGGTCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000080627    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019837.1-676s1c1
Sequence:CCGGCGTCATACTTTGAGACGTTGACTCGAGTCAACGTCTCAAAGTATGACGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000080623    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019837.1-1101s1c1
Sequence:CCGGGCCAGATATTTCCTCTGAATTCTCGAGAATTCAGAGGAAATATCTGGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000334528    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019837.2-543s21c2
Sequence:CCGGGACCTACGTGTATGTGCTCATCTCGAGATGAGCACATACACGTAGGTCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000351478    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019837.2-677s21c4
Sequence:CCGGCGTCATACTTTGAGACGTTGACTCGAGTCAACGTCTCAAAGTATGACGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000334578    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019837.2-388s21c2
Sequence:CCGGCGCCATCCAGACCGATGGATTCTCGAGAATCCATCGGTCTGGATGGCGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???