EMAIL THIS PAGE TO A FRIEND

NUDT4P1

nudix (nucleoside diphosphate linked moiety X)-type motif 4 pseudogene 1

12 Gene Product Result for
Species: Human NUDT4P1(440672)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_496393 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_496393 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_496393 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NR_002212 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NR_002212 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00375696 predicted 1492
2 SASI_Hs02_00375697 predicted 1647
3 SASI_Hs02_00375698 predicted 1450
4 SASI_Hs02_00375699 predicted 1787
5 SASI_Hs02_00375700 predicted 1559
6 SASI_Hs02_00375701 predicted 1764
7 SASI_Hs02_00375702 predicted 1740
8 SASI_Hs02_00375703 predicted 1411
9 SASI_Hs02_00375704 predicted 1542
10 SASI_Hs02_00375705 predicted 1630
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_496393
NUDT4P1 MISSION shRNA Bacterial Glycerol Stock
nudix (nucleoside diphosphate linked moiety X)-type motif 4 pseudogene 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000050843    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_496393.1-2839s1c1
Sequence:CCGGCCACAAATTGACACTTTCTATCTCGAGATAGAAAGTGTCAATTTGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050846    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_496393.1-732s1c1
Sequence:CCGGGAGTGGTTCAAAGTAGAAGATCTCGAGATCTTCTACTTTGAACCACTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050847    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_496393.1-853s1c1
Sequence:CCGGCCCTTCGGATAATAATGCCTTCTCGAGAAGGCATTATTATCCGAAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050844    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_496393.1-848s1c1
Sequence:CCGGCCCTTCCCTTCGGATAATAATCTCGAGATTATTATCCGAAGGGAAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050845    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_496393.1-566s1c1
Sequence:CCGGCGTGAGGGAAGTTTATGAGGACTCGAGTCCTCATAAACTTCCCTCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_496393
NUDT4P1 MISSION shRNA shRNA Plasmid DNA
nudix (nucleoside diphosphate linked moiety X)-type motif 4 pseudogene 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000050843    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_496393.1-2839s1c1
Sequence:CCGGCCACAAATTGACACTTTCTATCTCGAGATAGAAAGTGTCAATTTGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050846    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_496393.1-732s1c1
Sequence:CCGGGAGTGGTTCAAAGTAGAAGATCTCGAGATCTTCTACTTTGAACCACTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050847    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_496393.1-853s1c1
Sequence:CCGGCCCTTCGGATAATAATGCCTTCTCGAGAAGGCATTATTATCCGAAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050844    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_496393.1-848s1c1
Sequence:CCGGCCCTTCCCTTCGGATAATAATCTCGAGATTATTATCCGAAGGGAAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050845    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_496393.1-566s1c1
Sequence:CCGGCGTGAGGGAAGTTTATGAGGACTCGAGTCCTCATAAACTTCCCTCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_496393
NUDT4P1 MISSION shRNA Lentiviral Transduction Particles
nudix (nucleoside diphosphate linked moiety X)-type motif 4 pseudogene 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000050843    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_496393.1-2839s1c1
Sequence:CCGGCCACAAATTGACACTTTCTATCTCGAGATAGAAAGTGTCAATTTGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050846    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_496393.1-732s1c1
Sequence:CCGGGAGTGGTTCAAAGTAGAAGATCTCGAGATCTTCTACTTTGAACCACTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050847    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_496393.1-853s1c1
Sequence:CCGGCCCTTCGGATAATAATGCCTTCTCGAGAAGGCATTATTATCCGAAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050844    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_496393.1-848s1c1
Sequence:CCGGCCCTTCCCTTCGGATAATAATCTCGAGATTATTATCCGAAGGGAAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050845    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_496393.1-566s1c1
Sequence:CCGGCGTGAGGGAAGTTTATGAGGACTCGAGTCCTCATAAACTTCCCTCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)