EMAIL THIS PAGE TO A FRIEND

NUDT5

nudix (nucleoside diphosphate linked moiety X)-type motif 5

64 Gene Product Result for
Synonyms: YSA1 YSA1H YSAH1 hYSAH1
UniProtKB ID: Q9UKK9, A8K516, Q6IAG0, Q9UH49
Gene ID:
Human(11164) Summary: Nudix hydrolases, such as NUDT5, eliminate toxic nucleotide derivatives from the cell and regulate the levels of important signaling nucleotides and their metabolites (McLennan, 1999 [PubMed 10373642]
Mouse(53893) nudix (nucleoside diphosphate linked moiety X)-type motif 5
Rat(361274) nudix (nucleoside diphosphate linked moiety X)-type motif 5
Thale Cress(814983) nudix hydrolase 5
domestic cat(101084635) nudix (nucleoside diphosphate linked moiety X)-type motif 5
cow(614149) nudix (nucleoside diphosphate linked moiety X)-type motif 5
dog(478006) nudix (nucleoside diphosphate linked moiety X)-type motif 5
Zebrafish(415176) nudix (nucleoside diphosphate linked moiety X)-type motif 5
sheep(101117779) nudix (nucleoside diphosphate linked moiety X)-type motif 5
naked mole-rat(101722031) nudix (nucleoside diphosphate linked moiety X)-type motif 5
domestic guinea pig(100723448) nudix (nucleoside diphosphate linked moiety X)-type motif 5
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014142 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014142 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014142 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_016918 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_016918 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_016918 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014142 Rosetta Predictions human pricing
NM_001007733 Rosetta Predictions rat pricing
NM_016918 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014142 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00109215 predicted 473
2 SASI_Hs02_00345134 predicted 636
3 SASI_Hs01_00109216 predicted 516
4 SASI_Hs01_00109217 predicted 518
5 SASI_Hs01_00109218 predicted 951
6 SASI_Hs01_00109219 predicted 905
7 SASI_Hs01_00109220 predicted 781
8 SASI_Hs01_00109221 predicted 816
9 SASI_Hs01_00109222 predicted 633
10 SASI_Hs01_00109224 predicted 653
11 SASI_Hs01_00109223 predicted 918
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001007733 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00104705 predicted 869
2 SASI_Rn01_00104706 predicted 1000
3 SASI_Rn01_00104707 predicted 861
4 SASI_Rn01_00104708 predicted 1042
5 SASI_Rn01_00104710 predicted 1079
6 SASI_Rn02_00198919 predicted 587
7 SASI_Rn01_00104712 predicted 1053
8 SASI_Rn01_00104713 predicted 296
9 SASI_Rn01_00104714 predicted 737
10 SASI_Rn02_00198920 predicted 638
11 SASI_Rn01_00104709 predicted 610
12 SASI_Rn01_00104711 predicted 642
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016918 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00062205 predicted 1118
2 SASI_Mm01_00062206 predicted 1068
3 SASI_Mm01_00062207 predicted 834
4 SASI_Mm01_00062208 predicted 541
5 SASI_Mm01_00062209 predicted 880
6 SASI_Mm02_00323781 predicted 433
7 SASI_Mm01_00062210 predicted 1108
8 SASI_Mm01_00062212 predicted 1093
9 SASI_Mm01_00062213 predicted 1096
10 SASI_Mm01_00062214 predicted 662
11 SASI_Mm01_00062211 predicted 586
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014142
VALIDATED
NUDT5 MISSION shRNA Bacterial Glycerol Stock
nudix (nucleoside diphosphate linked moiety X)-type motif 5
Human
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000052073    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_014142.2-1046s1c1
Sequence:CCGGGCCATTTGAAGTGCCCTTCTTCTCGAGAAGAAGGGCACTTCAAATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052076    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_014142.2-1035s1c1
Sequence:CCGGGCAAATGCAAAGCCATTTGAACTCGAGTTCAAATGGCTTTGCATTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052077    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_014142.2-702s1c1
Sequence:CCGGGCAGGTCTCATAGATGATGGTCTCGAGACCATCATCTATGAGACCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052075    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014142.2-449s1c1
Sequence:CCGGGAATGGCAAACAGTATATCATCTCGAGATGATATACTGTTTGCCATTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052074    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_014142.2-520s1c1
Sequence:CCGGCGTACATGGATCCTACTGGTACTCGAGTACCAGTAGGATCCATGTACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218277    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_014142.2-910s21c1
Sequence:GTACCGGGAGAGTTTGTGGAAGTCATTTCTCGAGAAATGACTTCCACAAACTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229844    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_014142.2-843s21c1
Sequence:CCGGATCGTGACAGTCACCATTAACCTCGAGGTTAATGGTGACTGTCACGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229843    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_014142.2-820s21c1
Sequence:CCGGGCTTGTCAAACTGTACTATACCTCGAGGTATAGTACAGTTTGACAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229842    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_014142.2-522s21c1
Sequence:CCGGTACATGGATCCTACTGGTAAACTCGAGTTTACCAGTAGGATCCATGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229841    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_014142.2-451s21c1
Sequence:CCGGATGGCAAACAGTATATCATTTCTCGAGAAATGATATACTGTTTGCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262677    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_014142.2-547s21c1
Sequence:CCGGGAACTTGGGAATCAGTGAAACCTCGAGGTTTCACTGATTCCCAAGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262676    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_014142.2-1012s21c1
Sequence:CCGGCCTACGCTCTAGCACTGAAACCTCGAGGTTTCAGTGCTAGAGCGTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262675    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_014142.2-756s21c1
Sequence:CCGGGAAGAAGAAACTGGCTACAAACTCGAGTTTGTAGCCAGTTTCTTCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000281555    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014142.2-791s21c1
Sequence:CCGGATGTTCTCCAGCGGTCTGTATCTCGAGATACAGACCGCTGGAGAACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000282372    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_014142.2-640s21c1
Sequence:CCGGAGTGTATCGTTCTGGTGAAACCTCGAGGTTTCACCAGAACGATACACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014142
VALIDATED
NUDT5 MISSION shRNA shRNA Plasmid DNA
nudix (nucleoside diphosphate linked moiety X)-type motif 5
Human
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000052073    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_014142.2-1046s1c1
Sequence:CCGGGCCATTTGAAGTGCCCTTCTTCTCGAGAAGAAGGGCACTTCAAATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052076    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_014142.2-1035s1c1
Sequence:CCGGGCAAATGCAAAGCCATTTGAACTCGAGTTCAAATGGCTTTGCATTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052077    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_014142.2-702s1c1
Sequence:CCGGGCAGGTCTCATAGATGATGGTCTCGAGACCATCATCTATGAGACCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052075    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014142.2-449s1c1
Sequence:CCGGGAATGGCAAACAGTATATCATCTCGAGATGATATACTGTTTGCCATTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052074    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_014142.2-520s1c1
Sequence:CCGGCGTACATGGATCCTACTGGTACTCGAGTACCAGTAGGATCCATGTACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000218277    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_014142.2-910s21c1
Sequence:GTACCGGGAGAGTTTGTGGAAGTCATTTCTCGAGAAATGACTTCCACAAACTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000229844    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_014142.2-843s21c1
Sequence:CCGGATCGTGACAGTCACCATTAACCTCGAGGTTAATGGTGACTGTCACGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000229843    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_014142.2-820s21c1
Sequence:CCGGGCTTGTCAAACTGTACTATACCTCGAGGTATAGTACAGTTTGACAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000229842    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_014142.2-522s21c1
Sequence:CCGGTACATGGATCCTACTGGTAAACTCGAGTTTACCAGTAGGATCCATGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000229841    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_014142.2-451s21c1
Sequence:CCGGATGGCAAACAGTATATCATTTCTCGAGAAATGATATACTGTTTGCCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000262677    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_014142.2-547s21c1
Sequence:CCGGGAACTTGGGAATCAGTGAAACCTCGAGGTTTCACTGATTCCCAAGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000262676    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_014142.2-1012s21c1
Sequence:CCGGCCTACGCTCTAGCACTGAAACCTCGAGGTTTCAGTGCTAGAGCGTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000262675    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_014142.2-756s21c1
Sequence:CCGGGAAGAAGAAACTGGCTACAAACTCGAGTTTGTAGCCAGTTTCTTCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000281555    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014142.2-791s21c1
Sequence:CCGGATGTTCTCCAGCGGTCTGTATCTCGAGATACAGACCGCTGGAGAACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000282372    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_014142.2-640s21c1
Sequence:CCGGAGTGTATCGTTCTGGTGAAACCTCGAGGTTTCACCAGAACGATACACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014142
VALIDATED
NUDT5 MISSION shRNA Lentiviral Transduction Particles
nudix (nucleoside diphosphate linked moiety X)-type motif 5
Human
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000052073    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_014142.2-1046s1c1
Sequence:CCGGGCCATTTGAAGTGCCCTTCTTCTCGAGAAGAAGGGCACTTCAAATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052076    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_014142.2-1035s1c1
Sequence:CCGGGCAAATGCAAAGCCATTTGAACTCGAGTTCAAATGGCTTTGCATTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052077    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_014142.2-702s1c1
Sequence:CCGGGCAGGTCTCATAGATGATGGTCTCGAGACCATCATCTATGAGACCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052075    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014142.2-449s1c1
Sequence:CCGGGAATGGCAAACAGTATATCATCTCGAGATGATATACTGTTTGCCATTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052074    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_014142.2-520s1c1
Sequence:CCGGCGTACATGGATCCTACTGGTACTCGAGTACCAGTAGGATCCATGTACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218277    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_014142.2-910s21c1
Sequence:GTACCGGGAGAGTTTGTGGAAGTCATTTCTCGAGAAATGACTTCCACAAACTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229844    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_014142.2-843s21c1
Sequence:CCGGATCGTGACAGTCACCATTAACCTCGAGGTTAATGGTGACTGTCACGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229843    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_014142.2-820s21c1
Sequence:CCGGGCTTGTCAAACTGTACTATACCTCGAGGTATAGTACAGTTTGACAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229842    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_014142.2-522s21c1
Sequence:CCGGTACATGGATCCTACTGGTAAACTCGAGTTTACCAGTAGGATCCATGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229841    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_014142.2-451s21c1
Sequence:CCGGATGGCAAACAGTATATCATTTCTCGAGAAATGATATACTGTTTGCCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262677    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_014142.2-547s21c1
Sequence:CCGGGAACTTGGGAATCAGTGAAACCTCGAGGTTTCACTGATTCCCAAGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262676    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_014142.2-1012s21c1
Sequence:CCGGCCTACGCTCTAGCACTGAAACCTCGAGGTTTCAGTGCTAGAGCGTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262675    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_014142.2-756s21c1
Sequence:CCGGGAAGAAGAAACTGGCTACAAACTCGAGTTTGTAGCCAGTTTCTTCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000281555    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014142.2-791s21c1
Sequence:CCGGATGTTCTCCAGCGGTCTGTATCTCGAGATACAGACCGCTGGAGAACATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000282372    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_014142.2-640s21c1
Sequence:CCGGAGTGTATCGTTCTGGTGAAACCTCGAGGTTTCACCAGAACGATACACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016918
VALIDATED
NUDT5 MISSION shRNA Bacterial Glycerol Stock
nudix (nucleoside diphosphate linked moiety X)-type motif 5
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000114154    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016918.2-749s1c1
Sequence:CCGGACAAAGGTGAAGTTGCGGAATCTCGAGATTCCGCAACTTCACCTTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114153    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016918.2-829s1c1
Sequence:CCGGGTGACCATCAATGGAGATGATCTCGAGATCATCTCCATTGATGGTCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114155    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016918.2-543s1c1
Sequence:CCGGACTTACAACCAGGAAGGGAAACTCGAGTTTCCCTTCCTGGTTGTAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114151    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016918.2-1326s1c1
Sequence:CCGGGCTCCCAATTAGGTCAGCTATCTCGAGATAGCTGACCTAATTGGGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114152    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016918.2-927s1c1
Sequence:CCGGGCTGACAAGACTTGACGCTTTCTCGAGAAAGCGTCAAGTCTTGTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000331933    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016918.3-1325s21c1
Sequence:CCGGGCTCCCAATTAGGTCAGCTATCTCGAGATAGCTGACCTAATTGGGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309376    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016918.3-542s21c1
Sequence:CCGGACTTACAACCAGGAAGGGAAACTCGAGTTTCCCTTCCTGGTTGTAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309310    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016918.3-748s21c1
Sequence:CCGGACAAAGGTGAAGTTGCGGAATCTCGAGATTCCGCAACTTCACCTTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309378    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016918.3-828s21c1
Sequence:CCGGGTGACCATCAATGGAGATGATCTCGAGATCATCTCCATTGATGGTCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016918
VALIDATED
NUDT5 MISSION shRNA shRNA Plasmid DNA
nudix (nucleoside diphosphate linked moiety X)-type motif 5
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000114154    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016918.2-749s1c1
Sequence:CCGGACAAAGGTGAAGTTGCGGAATCTCGAGATTCCGCAACTTCACCTTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000114153    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016918.2-829s1c1
Sequence:CCGGGTGACCATCAATGGAGATGATCTCGAGATCATCTCCATTGATGGTCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000114155    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016918.2-543s1c1
Sequence:CCGGACTTACAACCAGGAAGGGAAACTCGAGTTTCCCTTCCTGGTTGTAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000114151    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016918.2-1326s1c1
Sequence:CCGGGCTCCCAATTAGGTCAGCTATCTCGAGATAGCTGACCTAATTGGGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000114152    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016918.2-927s1c1
Sequence:CCGGGCTGACAAGACTTGACGCTTTCTCGAGAAAGCGTCAAGTCTTGTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000331933    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016918.3-1325s21c1
Sequence:CCGGGCTCCCAATTAGGTCAGCTATCTCGAGATAGCTGACCTAATTGGGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000309376    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016918.3-542s21c1
Sequence:CCGGACTTACAACCAGGAAGGGAAACTCGAGTTTCCCTTCCTGGTTGTAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000309310    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016918.3-748s21c1
Sequence:CCGGACAAAGGTGAAGTTGCGGAATCTCGAGATTCCGCAACTTCACCTTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000309378    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016918.3-828s21c1
Sequence:CCGGGTGACCATCAATGGAGATGATCTCGAGATCATCTCCATTGATGGTCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016918
VALIDATED
NUDT5 MISSION shRNA Lentiviral Transduction Particles
nudix (nucleoside diphosphate linked moiety X)-type motif 5
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000114154    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016918.2-749s1c1
Sequence:CCGGACAAAGGTGAAGTTGCGGAATCTCGAGATTCCGCAACTTCACCTTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114153    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016918.2-829s1c1
Sequence:CCGGGTGACCATCAATGGAGATGATCTCGAGATCATCTCCATTGATGGTCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114155    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016918.2-543s1c1
Sequence:CCGGACTTACAACCAGGAAGGGAAACTCGAGTTTCCCTTCCTGGTTGTAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114151    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016918.2-1326s1c1
Sequence:CCGGGCTCCCAATTAGGTCAGCTATCTCGAGATAGCTGACCTAATTGGGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114152    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016918.2-927s1c1
Sequence:CCGGGCTGACAAGACTTGACGCTTTCTCGAGAAAGCGTCAAGTCTTGTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000331933    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016918.3-1325s21c1
Sequence:CCGGGCTCCCAATTAGGTCAGCTATCTCGAGATAGCTGACCTAATTGGGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309376    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016918.3-542s21c1
Sequence:CCGGACTTACAACCAGGAAGGGAAACTCGAGTTTCCCTTCCTGGTTGTAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309310    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016918.3-748s21c1
Sequence:CCGGACAAAGGTGAAGTTGCGGAATCTCGAGATTCCGCAACTTCACCTTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309378    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016918.3-828s21c1
Sequence:CCGGGTGACCATCAATGGAGATGATCTCGAGATCATCTCCATTGATGGTCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)