EMAIL THIS PAGE TO A FRIEND

NUFIP1

nuclear fragile X mental retardation protein interacting protein 1

81 Gene Product Result for
Synonyms: NUFIP bA540M5.1
UniProtKB ID: Q9UHK0, Q8WVM5, Q96SG1
Gene ID:
Human(26747) Summary: This gene encodes a nuclear RNA binding protein that contains a C2H2 zinc finger motif and a nuclear localization signal. This protein is associated with the nuclear matrix in perichromatin fibrils and, in neurons, localizes to the cytoplasm in association with endoplasmic reticulum ribosomes. This protein interacts with the fragile X mental retardation protein (FMRP), the tumor suppressor protein BRCA1, upregulates RNA polymerase II transcription, and is involved in box C/D snoRNP biogenesis. A pseudogene of this gene resides on chromosome 6q12. [provided by RefSeq, Feb 2012]
Mouse(27275) nuclear fragile X mental retardation protein interacting protein 1
Rat(364430) nuclear fragile X mental retardation protein interacting protein 1
chicken(418841) nuclear fragile X mental retardation protein interacting protein 1
dog(485458) nuclear fragile X mental retardation protein interacting protein 1
cow(509599) nuclear fragile X mental retardation protein interacting protein 1
Horse(100059457) nuclear fragile X mental retardation protein interacting protein 1
domestic cat(101084594) nuclear fragile X mental retardation protein interacting protein 1
sheep(101103075) nuclear fragile X mental retardation protein interacting protein 1
naked mole-rat(101718988) nuclear fragile X mental retardation protein interacting protein 1
Domestic Rabbit(100341859) nuclear fragile X mental retardation protein interacting protein 1
domestic guinea pig(100715077) nuclear fragile X mental retardation protein interacting protein 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_013745 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013745 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013745 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_012345 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012345 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012345 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU147111 MISSION® esiRNA esiRNA human NUFIP1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_012345 Rosetta Predictions human pricing
NM_001007758 Rosetta Predictions rat pricing
NM_013745 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012345 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00060779 predicted 1364
2 SASI_Hs01_00060780 predicted 843
3 SASI_Hs01_00060781 predicted 1417
4 SASI_Hs01_00060783 predicted 1422
5 SASI_Hs01_00060784 predicted 1565
6 SASI_Hs01_00060785 predicted 850
7 SASI_Hs01_00060786 predicted 977
8 SASI_Hs01_00060787 predicted 881
9 SASI_Hs01_00060788 predicted 1052
10 SASI_Hs02_00344156 predicted 1086
11 SASI_Hs01_00060782 predicted 747
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001007758 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00052319 predicted 1067
2 SASI_Rn01_00052320 predicted 1344
3 SASI_Rn01_00052322 predicted 1355
4 SASI_Rn01_00052323 predicted 938
5 SASI_Rn01_00052324 predicted 1257
6 SASI_Rn01_00052325 predicted 1019
7 SASI_Rn02_00198954 predicted 825
8 SASI_Rn01_00052327 predicted 956
9 SASI_Rn01_00052328 predicted 1194
10 SASI_Rn02_00198955 predicted 212
11 SASI_Rn01_00052321 predicted 830
12 SASI_Rn01_00052326 predicted 863
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013745 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00127659 predicted 753
2 SASI_Mm01_00127660 predicted 382
3 SASI_Mm01_00127661 predicted 1285
4 SASI_Mm01_00127662 predicted 1009
5 SASI_Mm01_00127663 predicted 421
6 SASI_Mm01_00127664 predicted 580
7 SASI_Mm01_00127665 predicted 819
8 SASI_Mm01_00127666 predicted 1192
9 SASI_Mm01_00127667 predicted 1373
10 SASI_Mm01_00127668 predicted 1491
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013745
NUFIP1 MISSION shRNA Bacterial Glycerol Stock
nuclear fragile X mental retardation protein interacting protein 1
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000175142    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_013745.2-2156s1c1
Sequence:CCGGGCCGTAAAGGAAATGACTTTACTCGAGTAAAGTCATTTCCTTTACGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215332    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013745.5-431s1c1
Sequence:CCGGCTCCGGTTACACATTCTTATTCTCGAGAATAAGAATGTGTAACCGGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217234    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013745.5-1348s1c1
Sequence:CCGGCCAAGAACACATCACCCATATCTCGAGATATGGGTGATGTGTTCTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240755    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013745.5-755s21c1
Sequence:CCGGACCCAACTCTGGCCAATATTGCTCGAGCAATATTGGCCAGAGTTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240754    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013745.5-3080s21c1
Sequence:CCGGGCTTGATTTAGCCAGATATATCTCGAGATATATCTGGCTAAATCAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240753    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013745.5-1420s21c1
Sequence:CCGGTTGCAGTGTGTTCGATATATCCTCGAGGATATATCGAACACACTGCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240752    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013745.5-406s21c1
Sequence:CCGGTCCACGTACCACACGTCTTACCTCGAGGTAAGACGTGTGGTACGTGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240751    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013745.5-1323s21c1
Sequence:CCGGGAGCCACTGTCACCCATTATTCTCGAGAATAATGGGTGACAGTGGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013745
NUFIP1 MISSION shRNA shRNA Plasmid DNA
nuclear fragile X mental retardation protein interacting protein 1
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000175142    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_013745.2-2156s1c1
Sequence:CCGGGCCGTAAAGGAAATGACTTTACTCGAGTAAAGTCATTTCCTTTACGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000215332    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013745.5-431s1c1
Sequence:CCGGCTCCGGTTACACATTCTTATTCTCGAGAATAAGAATGTGTAACCGGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000217234    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013745.5-1348s1c1
Sequence:CCGGCCAAGAACACATCACCCATATCTCGAGATATGGGTGATGTGTTCTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000240755    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013745.5-755s21c1
Sequence:CCGGACCCAACTCTGGCCAATATTGCTCGAGCAATATTGGCCAGAGTTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000240754    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013745.5-3080s21c1
Sequence:CCGGGCTTGATTTAGCCAGATATATCTCGAGATATATCTGGCTAAATCAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000240753    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013745.5-1420s21c1
Sequence:CCGGTTGCAGTGTGTTCGATATATCCTCGAGGATATATCGAACACACTGCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000240752    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013745.5-406s21c1
Sequence:CCGGTCCACGTACCACACGTCTTACCTCGAGGTAAGACGTGTGGTACGTGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000240751    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013745.5-1323s21c1
Sequence:CCGGGAGCCACTGTCACCCATTATTCTCGAGAATAATGGGTGACAGTGGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013745
NUFIP1 MISSION shRNA Lentiviral Transduction Particles
nuclear fragile X mental retardation protein interacting protein 1
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000175142    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_013745.2-2156s1c1
Sequence:CCGGGCCGTAAAGGAAATGACTTTACTCGAGTAAAGTCATTTCCTTTACGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215332    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013745.5-431s1c1
Sequence:CCGGCTCCGGTTACACATTCTTATTCTCGAGAATAAGAATGTGTAACCGGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217234    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013745.5-1348s1c1
Sequence:CCGGCCAAGAACACATCACCCATATCTCGAGATATGGGTGATGTGTTCTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240755    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013745.5-755s21c1
Sequence:CCGGACCCAACTCTGGCCAATATTGCTCGAGCAATATTGGCCAGAGTTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240754    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013745.5-3080s21c1
Sequence:CCGGGCTTGATTTAGCCAGATATATCTCGAGATATATCTGGCTAAATCAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240753    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013745.5-1420s21c1
Sequence:CCGGTTGCAGTGTGTTCGATATATCCTCGAGGATATATCGAACACACTGCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240752    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013745.5-406s21c1
Sequence:CCGGTCCACGTACCACACGTCTTACCTCGAGGTAAGACGTGTGGTACGTGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240751    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013745.5-1323s21c1
Sequence:CCGGGAGCCACTGTCACCCATTATTCTCGAGAATAATGGGTGACAGTGGCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012345
VALIDATED
NUFIP1 MISSION shRNA Bacterial Glycerol Stock
nuclear fragile X mental retardation protein interacting protein 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000172320    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012345.1-935s1c1
Sequence:CCGGCAGGCAGTCACTTGTGTGATTCTCGAGAATCACACAAGTGACTGCCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168556    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012345.1-802s1c1
Sequence:CCGGGCAGTATTGACAACAACACAACTCGAGTTGTGTTGTTGTCAATACTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168352    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012345.1-1206s1c1
Sequence:CCGGGAGTCCAAGTCAAGATGTTAACTCGAGTTAACATCTTGACTTGGACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168255    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012345.1-639s1c1
Sequence:CCGGCCAGTTCCATTGGAGAAATATCTCGAGATATTTCTCCAATGGAACTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350781    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012345.2-1412s21c1
Sequence:CCGGTGCTTCTAGCTCCGGACATTCCTCGAGGAATGTCCGGAGCTAGAAGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336992    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_012345.2-882s21c1
Sequence:CCGGGATGTCCAGACATTCACAAATCTCGAGATTTGTGAATGTCTGGACATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336990    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012345.2-1737s21c1
Sequence:CCGGGTTGGGATTGAATCTAGTATTCTCGAGAATACTAGATTCAATCCCAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336989    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012345.2-380s21c1
Sequence:CCGGATGCTTCCACATCGTGGTATTCTCGAGAATACCACGATGTGGAAGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337061    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_012345.2-1356s21c1
Sequence:CCGGTCACAACTATCAAACGTTATTCTCGAGAATAACGTTTGATAGTTGTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012345
VALIDATED
NUFIP1 MISSION shRNA shRNA Plasmid DNA
nuclear fragile X mental retardation protein interacting protein 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000172320    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012345.1-935s1c1
Sequence:CCGGCAGGCAGTCACTTGTGTGATTCTCGAGAATCACACAAGTGACTGCCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000168556    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012345.1-802s1c1
Sequence:CCGGGCAGTATTGACAACAACACAACTCGAGTTGTGTTGTTGTCAATACTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000168352    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012345.1-1206s1c1
Sequence:CCGGGAGTCCAAGTCAAGATGTTAACTCGAGTTAACATCTTGACTTGGACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000168255    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012345.1-639s1c1
Sequence:CCGGCCAGTTCCATTGGAGAAATATCTCGAGATATTTCTCCAATGGAACTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000350781    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012345.2-1412s21c1
Sequence:CCGGTGCTTCTAGCTCCGGACATTCCTCGAGGAATGTCCGGAGCTAGAAGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000336992    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_012345.2-882s21c1
Sequence:CCGGGATGTCCAGACATTCACAAATCTCGAGATTTGTGAATGTCTGGACATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000336990    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012345.2-1737s21c1
Sequence:CCGGGTTGGGATTGAATCTAGTATTCTCGAGAATACTAGATTCAATCCCAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000336989    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012345.2-380s21c1
Sequence:CCGGATGCTTCCACATCGTGGTATTCTCGAGAATACCACGATGTGGAAGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000337061    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_012345.2-1356s21c1
Sequence:CCGGTCACAACTATCAAACGTTATTCTCGAGAATAACGTTTGATAGTTGTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012345
VALIDATED
NUFIP1 MISSION shRNA Lentiviral Transduction Particles
nuclear fragile X mental retardation protein interacting protein 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000172320    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012345.1-935s1c1
Sequence:CCGGCAGGCAGTCACTTGTGTGATTCTCGAGAATCACACAAGTGACTGCCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168556    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012345.1-802s1c1
Sequence:CCGGGCAGTATTGACAACAACACAACTCGAGTTGTGTTGTTGTCAATACTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168352    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012345.1-1206s1c1
Sequence:CCGGGAGTCCAAGTCAAGATGTTAACTCGAGTTAACATCTTGACTTGGACTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168255    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012345.1-639s1c1
Sequence:CCGGCCAGTTCCATTGGAGAAATATCTCGAGATATTTCTCCAATGGAACTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350781    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012345.2-1412s21c1
Sequence:CCGGTGCTTCTAGCTCCGGACATTCCTCGAGGAATGTCCGGAGCTAGAAGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336992    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_012345.2-882s21c1
Sequence:CCGGGATGTCCAGACATTCACAAATCTCGAGATTTGTGAATGTCTGGACATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336990    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012345.2-1737s21c1
Sequence:CCGGGTTGGGATTGAATCTAGTATTCTCGAGAATACTAGATTCAATCCCAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336989    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012345.2-380s21c1
Sequence:CCGGATGCTTCCACATCGTGGTATTCTCGAGAATACCACGATGTGGAAGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337061    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_012345.2-1356s21c1
Sequence:CCGGTCACAACTATCAAACGTTATTCTCGAGAATAACGTTTGATAGTTGTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)