EMAIL THIS PAGE TO A FRIEND

NUFIP2

nuclear fragile X mental retardation protein interacting protein 2

224 Gene Product Result for
Synonyms: 182-FIP 82-FIP FIP-82
UniProtKB ID: Q7Z417, Q9P2M5
Gene ID:
Mouse(68564) nuclear fragile X mental retardation protein interacting protein 2
Rat(681371) nuclear fragile X mental retardation protein interacting protein 2
Zebrafish(492366) nuclear fragile X mental retardation protein interacting protein 2
dog(480631) nuclear fragile X mental retardation protein interacting protein 2
cow(781847) nuclear fragile X mental retardation protein interacting protein 2
Horse(100059671) nuclear fragile X mental retardation protein interacting protein 2
domestic cat(101093471) nuclear fragile X mental retardation protein interacting protein 2
chicken(417582) nuclear fragile X mental retardation protein interacting protein 2
domestic guinea pig(100724569) nuclear fragile X mental retardation protein interacting protein 2
Domestic Rabbit(100343082) nuclear fragile X mental retardation protein interacting protein 2
naked mole-rat(101697671) nuclear fragile X mental retardation protein interacting protein 2
sheep(101109461) nuclear fragile X mental retardation protein interacting protein 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020772 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020772 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020772 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001024205 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001024205 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001024205 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020772 Rosetta Predictions human pricing
NM_001024205 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020772 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00240082 predicted 1195
2 SASI_Hs01_00240083 predicted 675
3 SASI_Hs01_00240084 predicted 1387
4 SASI_Hs01_00240085 predicted 2067
5 SASI_Hs01_00240086 predicted 508
6 SASI_Hs01_00240087 predicted 1262
7 SASI_Hs01_00240088 predicted 1830
8 SASI_Hs01_00240090 predicted 690
9 SASI_Hs02_00353906 predicted 1404
10 SASI_Hs01_00240091 predicted 494
11 SASI_Hs01_00240089 predicted 1817
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024205 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00065028 predicted 808
2 SASI_Mm01_00065029 predicted 1366
3 SASI_Mm01_00065030 predicted 656
4 SASI_Mm01_00065032 predicted 2036
5 SASI_Mm01_00065033 predicted 1675
6 SASI_Mm01_00065034 predicted 1284
7 SASI_Mm01_00065035 predicted 979
8 SASI_Mm01_00065036 predicted 1881
9 SASI_Mm02_00287570 predicted 621
10 SASI_Mm01_00065037 predicted 682
11 SASI_Mm01_00065031 predicted 1990
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020772
NUFIP2 MISSION shRNA Bacterial Glycerol Stock
nuclear fragile X mental retardation protein interacting protein 2
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000349671    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020772.2-1262s21c1
Sequence:CCGGGACCCAATCATCAAGTCGCTTCTCGAGAAGCGACTTGATGATTGGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000349672    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020772.2-1482s21c1
Sequence:CCGGGAACAAATTAAGACTAGCCTTCTCGAGAAGGCTAGTCTTAATTTGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319179    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020772.2-864s21c1
Sequence:CCGGGAAACTTTCAAGCCTGACTATCTCGAGATAGTCAGGCTTGAAAGTTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000349607    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020772.2-2916s21c1
Sequence:CCGGCGGTTACATATTGGACTTTAACTCGAGTTAAAGTCCAATATGTAACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172531    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020772.1-1173s1c1
Sequence:CCGGGACCCAATCATCAAGTCGCTTCTCGAGAAGCGACTTGATGATTGGGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167367    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020772.1-775s1c1
Sequence:CCGGGAAACTTTCAAGCCTGACTATCTCGAGATAGTCAGGCTTGAAAGTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167110    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_020772.1-2827s1c1
Sequence:CCGGCGGTTACATATTGGACTTTAACTCGAGTTAAAGTCCAATATGTAACCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166959    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020772.1-1393s1c1
Sequence:CCGGGAACAAATTAAGACTAGCCTTCTCGAGAAGGCTAGTCTTAATTTGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020772
NUFIP2 MISSION shRNA shRNA Plasmid DNA
nuclear fragile X mental retardation protein interacting protein 2
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000349671    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020772.2-1262s21c1
Sequence:CCGGGACCCAATCATCAAGTCGCTTCTCGAGAAGCGACTTGATGATTGGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000349672    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020772.2-1482s21c1
Sequence:CCGGGAACAAATTAAGACTAGCCTTCTCGAGAAGGCTAGTCTTAATTTGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000319179    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020772.2-864s21c1
Sequence:CCGGGAAACTTTCAAGCCTGACTATCTCGAGATAGTCAGGCTTGAAAGTTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000349607    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020772.2-2916s21c1
Sequence:CCGGCGGTTACATATTGGACTTTAACTCGAGTTAAAGTCCAATATGTAACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000172531    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020772.1-1173s1c1
Sequence:CCGGGACCCAATCATCAAGTCGCTTCTCGAGAAGCGACTTGATGATTGGGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000167367    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020772.1-775s1c1
Sequence:CCGGGAAACTTTCAAGCCTGACTATCTCGAGATAGTCAGGCTTGAAAGTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000167110    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_020772.1-2827s1c1
Sequence:CCGGCGGTTACATATTGGACTTTAACTCGAGTTAAAGTCCAATATGTAACCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000166959    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020772.1-1393s1c1
Sequence:CCGGGAACAAATTAAGACTAGCCTTCTCGAGAAGGCTAGTCTTAATTTGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020772
NUFIP2 MISSION shRNA Lentiviral Transduction Particles
nuclear fragile X mental retardation protein interacting protein 2
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000349671    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020772.2-1262s21c1
Sequence:CCGGGACCCAATCATCAAGTCGCTTCTCGAGAAGCGACTTGATGATTGGGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000349672    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020772.2-1482s21c1
Sequence:CCGGGAACAAATTAAGACTAGCCTTCTCGAGAAGGCTAGTCTTAATTTGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319179    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020772.2-864s21c1
Sequence:CCGGGAAACTTTCAAGCCTGACTATCTCGAGATAGTCAGGCTTGAAAGTTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000349607    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020772.2-2916s21c1
Sequence:CCGGCGGTTACATATTGGACTTTAACTCGAGTTAAAGTCCAATATGTAACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172531    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020772.1-1173s1c1
Sequence:CCGGGACCCAATCATCAAGTCGCTTCTCGAGAAGCGACTTGATGATTGGGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167367    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020772.1-775s1c1
Sequence:CCGGGAAACTTTCAAGCCTGACTATCTCGAGATAGTCAGGCTTGAAAGTTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167110    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_020772.1-2827s1c1
Sequence:CCGGCGGTTACATATTGGACTTTAACTCGAGTTAAAGTCCAATATGTAACCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166959    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020772.1-1393s1c1
Sequence:CCGGGAACAAATTAAGACTAGCCTTCTCGAGAAGGCTAGTCTTAATTTGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001024205
VALIDATED
NUFIP2 MISSION shRNA Bacterial Glycerol Stock
nuclear fragile X mental retardation protein interacting protein 2
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000241122    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024205.1-712s21c1
Sequence:CCGGTGGATCTGAGAGTGGATATACCTCGAGGTATATCCACTCTCAGATCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241121    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024205.1-356s21c1
Sequence:CCGGTATGGTGAAATAAACGGTAATCTCGAGATTACCGTTTATTTCACCATATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241120    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001024205.1-651s21c1
Sequence:CCGGCAAGTAGTTCAGGCTATATTACTCGAGTAATATAGCCTGAACTACTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241119    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024205.1-418s21c1
Sequence:CCGGTGAAGCTACCAACCCTATTTCCTCGAGGAAATAGGGTTGGTAGCTTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241118    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001024205.1-7568s21c1
Sequence:CCGGATACCATAGGTTGCGTTAATACTCGAGTATTAACGCAACCTATGGTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201293    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001024205.1-882s1c1
Sequence:CCGGGAATGCGAGTAGATGGTTCAACTCGAGTTGAACCATCTACTCGCATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191977    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001024205.1-1454s1c1
Sequence:CCGGGCAGCCGTTGAACAAATTAAACTCGAGTTTAATTTGTTCAACGGCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191901    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001024205.1-981s1c1
Sequence:CCGGGCTCTGATATTAAACCTGGTTCTCGAGAACCAGGTTTAATATCAGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001024205
VALIDATED
NUFIP2 MISSION shRNA shRNA Plasmid DNA
nuclear fragile X mental retardation protein interacting protein 2
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000241122    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024205.1-712s21c1
Sequence:CCGGTGGATCTGAGAGTGGATATACCTCGAGGTATATCCACTCTCAGATCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241121    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024205.1-356s21c1
Sequence:CCGGTATGGTGAAATAAACGGTAATCTCGAGATTACCGTTTATTTCACCATATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241120    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001024205.1-651s21c1
Sequence:CCGGCAAGTAGTTCAGGCTATATTACTCGAGTAATATAGCCTGAACTACTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241119    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024205.1-418s21c1
Sequence:CCGGTGAAGCTACCAACCCTATTTCCTCGAGGAAATAGGGTTGGTAGCTTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241118    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001024205.1-7568s21c1
Sequence:CCGGATACCATAGGTTGCGTTAATACTCGAGTATTAACGCAACCTATGGTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000201293    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001024205.1-882s1c1
Sequence:CCGGGAATGCGAGTAGATGGTTCAACTCGAGTTGAACCATCTACTCGCATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000191977    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001024205.1-1454s1c1
Sequence:CCGGGCAGCCGTTGAACAAATTAAACTCGAGTTTAATTTGTTCAACGGCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000191901    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001024205.1-981s1c1
Sequence:CCGGGCTCTGATATTAAACCTGGTTCTCGAGAACCAGGTTTAATATCAGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001024205
VALIDATED
NUFIP2 MISSION shRNA Lentiviral Transduction Particles
nuclear fragile X mental retardation protein interacting protein 2
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000241122    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024205.1-712s21c1
Sequence:CCGGTGGATCTGAGAGTGGATATACCTCGAGGTATATCCACTCTCAGATCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241121    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024205.1-356s21c1
Sequence:CCGGTATGGTGAAATAAACGGTAATCTCGAGATTACCGTTTATTTCACCATATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241120    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001024205.1-651s21c1
Sequence:CCGGCAAGTAGTTCAGGCTATATTACTCGAGTAATATAGCCTGAACTACTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241119    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024205.1-418s21c1
Sequence:CCGGTGAAGCTACCAACCCTATTTCCTCGAGGAAATAGGGTTGGTAGCTTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241118    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001024205.1-7568s21c1
Sequence:CCGGATACCATAGGTTGCGTTAATACTCGAGTATTAACGCAACCTATGGTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201293    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001024205.1-882s1c1
Sequence:CCGGGAATGCGAGTAGATGGTTCAACTCGAGTTGAACCATCTACTCGCATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191977    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001024205.1-1454s1c1
Sequence:CCGGGCAGCCGTTGAACAAATTAAACTCGAGTTTAATTTGTTCAACGGCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191901    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001024205.1-981s1c1
Sequence:CCGGGCTCTGATATTAAACCTGGTTCTCGAGAACCAGGTTTAATATCAGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)