EMAIL THIS PAGE TO A FRIEND

NUMA1

nuclear mitotic apparatus protein 1

136 Gene Product Result for
Synonyms: NUMA
UniProtKB ID: Q14980, H0YH75, Q14981
Gene ID:
Mouse(101706) nuclear mitotic apparatus protein 1
Rat(308870) nuclear mitotic apparatus protein 1
Zebrafish(572344) nuclear mitotic apparatus protein 1
chicken(768717) nuclear mitotic apparatus protein 1
dog(485213) nuclear mitotic apparatus protein 1
Horse(100052884) nuclear mitotic apparatus protein 1
cow(513091) nuclear mitotic apparatus protein 1
domestic cat(101096349) nuclear mitotic apparatus protein 1
domestic guinea pig(100714541) nuclear mitotic apparatus protein 1
naked mole-rat(101700873) nuclear mitotic apparatus protein 1
Domestic Rabbit(100302677) nuclear mitotic apparatus protein 1
sheep(101119246) nuclear mitotic apparatus protein 1
Gene Class: Cytoskeleton
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA019841 Anti-NUMA1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution, Ab1 Antibody Enhanced Validation human
immunofluorescence, immunohistochemistry, western blot pricing
HPA019859 Anti-NUMA1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution, Ab2 human
immunohistochemistry pricing
SAB2101663 Anti-NUMA1 antibody produced in rabbit affinity isolated antibody rat, mouse, horse, bovine, human, dog, guinea pig, rabbit
western blot pricing
HPA029912 Anti-NUMA1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing
SAB1410850 Anti-NUMA1 antibody produced in rabbit purified immunoglobulin, buffered aqueous solution mouse, human
immunofluorescence, western blot pricing
SAB2702225 Monoclonal Anti-NuMA antibody produced in mouse clone GT1510, affinity isolated antibody human
immunofluorescence, western blot pricing
SAB2702236 Monoclonal Anti-NuMA antibody produced in mouse clone GT3611, affinity isolated antibody human
immunofluorescence, western blot pricing
WH0004926M1 Monoclonal Anti-NUMA1 antibody produced in mouse clone 1C5, purified immunoglobulin, buffered aqueous solution human
ELISA, immunoprecipitation (IP), western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_133947 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_133947 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_133947 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006185 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006185 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006185 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006185 Rosetta Predictions human pricing
XM_001068048 Rosetta Predictions rat pricing
XM_001068093 Rosetta Predictions rat pricing
XM_001068145 Rosetta Predictions rat pricing
XM_218972 Rosetta Predictions rat pricing
NM_133947 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006185 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00196841 predicted 2957
2 SASI_Hs01_00196842 predicted 1161
3 SASI_Hs01_00196843 predicted 2758
4 SASI_Hs01_00196844 predicted 4073
5 SASI_Hs01_00196845 predicted 1303
6 SASI_Hs01_00196846 predicted 1830
7 SASI_Hs01_00196847 predicted 635
8 SASI_Hs01_00196848 predicted 1141
9 SASI_Hs01_00196849 predicted 5480
10 SASI_Hs01_00196850 predicted 2672
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001068048 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00323235 predicted 1413
2 SASI_Rn02_00323236 predicted 6285
3 SASI_Rn02_00323237 predicted 2273
4 SASI_Rn02_00323238 predicted 2750
5 SASI_Rn02_00323239 predicted 1137
6 SASI_Rn02_00323240 predicted 1165
7 SASI_Rn02_00323241 predicted 570
8 SASI_Rn02_00323242 predicted 2259
9 SASI_Rn02_00323243 predicted 330
10 SASI_Rn02_00323244 predicted 3241
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001068093 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00323429 predicted 1501
2 SASI_Rn02_00323430 predicted 6403
3 SASI_Rn02_00323431 predicted 2355
4 SASI_Rn02_00323432 predicted 2833
5 SASI_Rn02_00323433 predicted 1220
6 SASI_Rn02_00323434 predicted 1249
7 SASI_Rn02_00323435 predicted 653
8 SASI_Rn02_00323436 predicted 2346
9 SASI_Rn02_00323437 predicted 411
10 SASI_Rn02_00323438 predicted 3326
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001068145 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00323606 predicted 1459
2 SASI_Rn02_00323607 predicted 6372
3 SASI_Rn02_00323608 predicted 2317
4 SASI_Rn02_00323609 predicted 2796
5 SASI_Rn02_00323610 predicted 1184
6 SASI_Rn02_00323611 predicted 1217
7 SASI_Rn02_00323612 predicted 620
8 SASI_Rn02_00323613 predicted 2311
9 SASI_Rn02_00323614 predicted 377
10 SASI_Rn02_00323615 predicted 3293
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_218972 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00378247 predicted 1309
2 SASI_Rn02_00378248 predicted 6218
3 SASI_Rn02_00378249 predicted 2168
4 SASI_Rn02_00378250 predicted 1029
5 SASI_Rn02_00378251 predicted 1064
6 SASI_Rn02_00378252 predicted 470
7 SASI_Rn02_00378253 predicted 2160
8 SASI_Rn02_00378254 predicted 221
9 SASI_Rn02_00378255 predicted 3136
10 SASI_Rn02_00378256 predicted 421
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133947 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00097185 predicted 1911
2 SASI_Mm01_00097186 predicted 4046
3 SASI_Mm01_00097187 predicted 408
4 SASI_Mm01_00097188 predicted 574
5 SASI_Mm01_00097189 predicted 2459
6 SASI_Mm01_00097191 predicted 557
7 SASI_Mm02_00339053 predicted 1129
8 SASI_Mm01_00097192 predicted 1143
9 SASI_Mm02_00339054 predicted 5185
10 SASI_Mm01_00097193 predicted 6010
11 SASI_Mm01_00097190 predicted 2102
12 SASI_Mm01_00097194 predicted 3529
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133947
VALIDATED
NUMA1 MISSION shRNA Bacterial Glycerol Stock
nuclear mitotic apparatus protein 1
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000348310    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133947.3-562s21c1
Sequence:CCGGGATCATGAGGAGTCGCTAAACCTCGAGGTTTAGCGACTCCTCATGATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309095    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133947.2-6790s21c1
Sequence:CCGGCCTTAGTCTCTGGACCTAGAACTCGAGTTCTAGGTCCAGAGACTAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305221    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133947.2-1386s21c1
Sequence:CCGGCTTGCAGCTGGACACTCTAAACTCGAGTTTAGAGTGTCCAGCTGCAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309178    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133947.2-1070s21c1
Sequence:CCGGGCCAGATGGATCGAAAGATTACTCGAGTAATCTTTCGATCCATCTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309177    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133947.2-2689s21c1
Sequence:CCGGGCAGTAGAGATCCACAGTGAACTCGAGTTCACTGTGGATCTCTACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311267    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133947.2-561s21c1
Sequence:CCGGGGATCATGAGGAGTCGCTAAACTCGAGTTTAGCGACTCCTCATGATCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072130    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133947.2-1070s1c1
Sequence:CCGGGCCAGATGGATCGAAAGATTACTCGAGTAATCTTTCGATCCATCTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072132    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133947.2-2689s1c1
Sequence:CCGGGCAGTAGAGATCCACAGTGAACTCGAGTTCACTGTGGATCTCTACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072131    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133947.2-4748s1c1
Sequence:CCGGCCCAGGTGGAAGAACTAAGTACTCGAGTACTTAGTTCTTCCACCTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072129    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133947.2-1950s1c1
Sequence:CCGGGCAGCTAGAAACAGTGGAGAACTCGAGTTCTCCACTGTTTCTAGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072128    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133947.2-6790s1c1
Sequence:CCGGCCTTAGTCTCTGGACCTAGAACTCGAGTTCTAGGTCCAGAGACTAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133947
VALIDATED
NUMA1 MISSION shRNA shRNA Plasmid DNA
nuclear mitotic apparatus protein 1
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000348310    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133947.3-562s21c1
Sequence:CCGGGATCATGAGGAGTCGCTAAACCTCGAGGTTTAGCGACTCCTCATGATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000309095    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133947.2-6790s21c1
Sequence:CCGGCCTTAGTCTCTGGACCTAGAACTCGAGTTCTAGGTCCAGAGACTAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000305221    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133947.2-1386s21c1
Sequence:CCGGCTTGCAGCTGGACACTCTAAACTCGAGTTTAGAGTGTCCAGCTGCAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000309178    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133947.2-1070s21c1
Sequence:CCGGGCCAGATGGATCGAAAGATTACTCGAGTAATCTTTCGATCCATCTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000309177    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133947.2-2689s21c1
Sequence:CCGGGCAGTAGAGATCCACAGTGAACTCGAGTTCACTGTGGATCTCTACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000311267    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133947.2-561s21c1
Sequence:CCGGGGATCATGAGGAGTCGCTAAACTCGAGTTTAGCGACTCCTCATGATCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072130    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133947.2-1070s1c1
Sequence:CCGGGCCAGATGGATCGAAAGATTACTCGAGTAATCTTTCGATCCATCTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072132    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133947.2-2689s1c1
Sequence:CCGGGCAGTAGAGATCCACAGTGAACTCGAGTTCACTGTGGATCTCTACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072131    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133947.2-4748s1c1
Sequence:CCGGCCCAGGTGGAAGAACTAAGTACTCGAGTACTTAGTTCTTCCACCTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072129    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133947.2-1950s1c1
Sequence:CCGGGCAGCTAGAAACAGTGGAGAACTCGAGTTCTCCACTGTTTCTAGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072128    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133947.2-6790s1c1
Sequence:CCGGCCTTAGTCTCTGGACCTAGAACTCGAGTTCTAGGTCCAGAGACTAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133947
VALIDATED
NUMA1 MISSION shRNA Lentiviral Transduction Particles
nuclear mitotic apparatus protein 1
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000348310    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133947.3-562s21c1
Sequence:CCGGGATCATGAGGAGTCGCTAAACCTCGAGGTTTAGCGACTCCTCATGATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309095    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133947.2-6790s21c1
Sequence:CCGGCCTTAGTCTCTGGACCTAGAACTCGAGTTCTAGGTCCAGAGACTAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305221    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133947.2-1386s21c1
Sequence:CCGGCTTGCAGCTGGACACTCTAAACTCGAGTTTAGAGTGTCCAGCTGCAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309178    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133947.2-1070s21c1
Sequence:CCGGGCCAGATGGATCGAAAGATTACTCGAGTAATCTTTCGATCCATCTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309177    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133947.2-2689s21c1
Sequence:CCGGGCAGTAGAGATCCACAGTGAACTCGAGTTCACTGTGGATCTCTACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311267    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133947.2-561s21c1
Sequence:CCGGGGATCATGAGGAGTCGCTAAACTCGAGTTTAGCGACTCCTCATGATCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072130    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133947.2-1070s1c1
Sequence:CCGGGCCAGATGGATCGAAAGATTACTCGAGTAATCTTTCGATCCATCTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072132    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133947.2-2689s1c1
Sequence:CCGGGCAGTAGAGATCCACAGTGAACTCGAGTTCACTGTGGATCTCTACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072131    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133947.2-4748s1c1
Sequence:CCGGCCCAGGTGGAAGAACTAAGTACTCGAGTACTTAGTTCTTCCACCTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072129    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133947.2-1950s1c1
Sequence:CCGGGCAGCTAGAAACAGTGGAGAACTCGAGTTCTCCACTGTTTCTAGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072128    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133947.2-6790s1c1
Sequence:CCGGCCTTAGTCTCTGGACCTAGAACTCGAGTTCTAGGTCCAGAGACTAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006185
VALIDATED
NUMA1 MISSION shRNA Bacterial Glycerol Stock
nuclear mitotic apparatus protein 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000286302    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_006185.2-5966s21c1
Sequence:CCGGCCACATCTGAAGACCTGCTATCTCGAGATAGCAGGTCTTCAGATGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293771    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_006185.2-6860s21c1
Sequence:CCGGTGGATCTAGAAGGGACCATAACTCGAGTTATGGTCCCTTCTAGATCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298552    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_006185.2-4984s21c1
Sequence:CCGGGCAGGCAGCTGAGCACTATAACTCGAGTTATAGTGCTCAGCTGCCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286303    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_006185.2-1296s21c1
Sequence:CCGGGCCTTGAAGAGAAGAACGAAACTCGAGTTTCGTTCTTCTCTTCAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286235    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_006185.2-2371s21c1
Sequence:CCGGGCGTTGTATCTCTGAGCTGAACTCGAGTTCAGCTCAGAGATACAACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333550    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006185.2-1297s21c1
Sequence:CCGGCCTTGAAGAGAAGAACGAAATCTCGAGATTTCGTTCTTCTCTTCAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074169    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006185.1-6010s1c1
Sequence:CCGGCCACATCTGAAGACCTGCTATCTCGAGATAGCAGGTCTTCAGATGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074172    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006185.1-2457s1c1
Sequence:CCGGGCGTTGTATCTCTGAGCTGAACTCGAGTTCAGCTCAGAGATACAACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074170    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006185.1-1383s1c1
Sequence:CCGGCCTTGAAGAGAAGAACGAAATCTCGAGATTTCGTTCTTCTCTTCAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074171    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006185.1-1382s1c1
Sequence:CCGGGCCTTGAAGAGAAGAACGAAACTCGAGTTTCGTTCTTCTCTTCAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006185
VALIDATED
NUMA1 MISSION shRNA shRNA Plasmid DNA
nuclear mitotic apparatus protein 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000286302    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_006185.2-5966s21c1
Sequence:CCGGCCACATCTGAAGACCTGCTATCTCGAGATAGCAGGTCTTCAGATGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000293771    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_006185.2-6860s21c1
Sequence:CCGGTGGATCTAGAAGGGACCATAACTCGAGTTATGGTCCCTTCTAGATCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000298552    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_006185.2-4984s21c1
Sequence:CCGGGCAGGCAGCTGAGCACTATAACTCGAGTTATAGTGCTCAGCTGCCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000286303    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_006185.2-1296s21c1
Sequence:CCGGGCCTTGAAGAGAAGAACGAAACTCGAGTTTCGTTCTTCTCTTCAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000286235    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_006185.2-2371s21c1
Sequence:CCGGGCGTTGTATCTCTGAGCTGAACTCGAGTTCAGCTCAGAGATACAACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000333550    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006185.2-1297s21c1
Sequence:CCGGCCTTGAAGAGAAGAACGAAATCTCGAGATTTCGTTCTTCTCTTCAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074169    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006185.1-6010s1c1
Sequence:CCGGCCACATCTGAAGACCTGCTATCTCGAGATAGCAGGTCTTCAGATGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074172    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006185.1-2457s1c1
Sequence:CCGGGCGTTGTATCTCTGAGCTGAACTCGAGTTCAGCTCAGAGATACAACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074170    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006185.1-1383s1c1
Sequence:CCGGCCTTGAAGAGAAGAACGAAATCTCGAGATTTCGTTCTTCTCTTCAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074171    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006185.1-1382s1c1
Sequence:CCGGGCCTTGAAGAGAAGAACGAAACTCGAGTTTCGTTCTTCTCTTCAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006185
VALIDATED
NUMA1 MISSION shRNA Lentiviral Transduction Particles
nuclear mitotic apparatus protein 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000286302    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_006185.2-5966s21c1
Sequence:CCGGCCACATCTGAAGACCTGCTATCTCGAGATAGCAGGTCTTCAGATGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293771    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_006185.2-6860s21c1
Sequence:CCGGTGGATCTAGAAGGGACCATAACTCGAGTTATGGTCCCTTCTAGATCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298552    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_006185.2-4984s21c1
Sequence:CCGGGCAGGCAGCTGAGCACTATAACTCGAGTTATAGTGCTCAGCTGCCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286303    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_006185.2-1296s21c1
Sequence:CCGGGCCTTGAAGAGAAGAACGAAACTCGAGTTTCGTTCTTCTCTTCAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286235    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_006185.2-2371s21c1
Sequence:CCGGGCGTTGTATCTCTGAGCTGAACTCGAGTTCAGCTCAGAGATACAACGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333550    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006185.2-1297s21c1
Sequence:CCGGCCTTGAAGAGAAGAACGAAATCTCGAGATTTCGTTCTTCTCTTCAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074169    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006185.1-6010s1c1
Sequence:CCGGCCACATCTGAAGACCTGCTATCTCGAGATAGCAGGTCTTCAGATGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074172    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006185.1-2457s1c1
Sequence:CCGGGCGTTGTATCTCTGAGCTGAACTCGAGTTCAGCTCAGAGATACAACGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074170    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006185.1-1383s1c1
Sequence:CCGGCCTTGAAGAGAAGAACGAAATCTCGAGATTTCGTTCTTCTCTTCAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074171    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006185.1-1382s1c1
Sequence:CCGGGCCTTGAAGAGAAGAACGAAACTCGAGTTTCGTTCTTCTCTTCAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)