EMAIL THIS PAGE TO A FRIEND

NUMB

numb homolog (Drosophila)

156 Gene Product Result for
Synonyms: C14orf41 S171 c14_5527
Gene ID:
Human(8650) Summary: The protein encoded by this gene plays a role in the determination of cell fates during development. The encoded protein, whose degradation is induced in a proteasome-dependent manner by MDM2, is a membrane-bound protein that has been shown to associate with EPS15, LNX1, and NOTCH1. Four transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(18222) numb gene homolog (Drosophila)
Rat(29419) numb homolog (Drosophila)
sheep(101102733) numb homolog (Drosophila)
Domestic Rabbit(100345271) numb homolog (Drosophila)
naked mole-rat(101714090) numb homolog (Drosophila)
domestic guinea pig(100728716) numb homolog (Drosophila)
fruit fly(34263) CG3779 gene product from transcript CG3779-RB
Zebrafish(692064) numb homolog (Drosophila)
dog(480381) numb homolog (Drosophila)
cow(512187) numb homolog (Drosophila)
Horse(100050235) numb homolog (Drosophila)
domestic cat(101087490) numb homolog (Drosophila)
chicken(395639) numb homolog (Drosophila)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010949 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010949 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010949 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003744 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003744 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003744 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU074891 MISSION® esiRNA esiRNA human NUMB (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001005743 Rosetta Predictions human pricing
NM_001005744 Rosetta Predictions human pricing
NM_001005745 Rosetta Predictions human pricing
NM_003744 Rosetta Predictions human pricing
NM_133287 Rosetta Predictions rat pricing
NM_010949 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001005743 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00245422 predicted 2344
2 SASI_Hs01_00245423 predicted 988
3 SASI_Hs02_00305013 predicted 1181
4 SASI_Hs01_00245425 predicted 1845
5 SASI_Hs01_00245426 predicted 960
6 SASI_Hs01_00245427 predicted 2293
7 SASI_Hs01_00245428 predicted 2271
8 SASI_Hs01_00245429 predicted 2346
9 SASI_Hs01_00245430 predicted 2268
10 SASI_Hs01_00245431 predicted 923
11 SASI_Hs01_00245424 predicted 1763
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001005744 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00199824 predicted 2202
2 SASI_Hs01_00199825 predicted 980
3 SASI_Hs02_00305014 predicted 1178
4 SASI_Hs01_00199827 predicted 1694
5 SASI_Hs01_00199828 predicted 965
6 SASI_Hs01_00199829 predicted 2142
7 SASI_Hs01_00199830 predicted 2128
8 SASI_Hs01_00199831 predicted 2198
9 SASI_Hs01_00199832 predicted 2123
10 SASI_Hs01_00199833 predicted 927
11 SASI_Hs01_00199826 predicted 1619
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001005745 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00045549 predicted 2164
2 SASI_Hs01_00045550 predicted 950
3 SASI_Hs02_00305015 predicted 1144
4 SASI_Hs01_00045552 predicted 1668
5 SASI_Hs01_00045553 predicted 931
6 SASI_Hs01_00045554 predicted 2113
7 SASI_Hs01_00045555 predicted 2100
8 SASI_Hs01_00045556 predicted 2170
9 SASI_Hs01_00045557 predicted 2091
10 SASI_Hs01_00045558 predicted 889
11 SASI_Hs01_00045551 predicted 1587
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003744 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00200677 predicted 2311
2 SASI_Hs01_00200678 predicted 949
3 SASI_Hs02_00336203 predicted 1150
4 SASI_Hs01_00200680 predicted 1811
5 SASI_Hs01_00200681 predicted 925
6 SASI_Hs01_00200682 predicted 2259
7 SASI_Hs01_00200683 predicted 2238
8 SASI_Hs01_00200684 predicted 2311
9 SASI_Hs01_00200685 predicted 2240
10 SASI_Hs01_00200686 predicted 892
11 SASI_Hs01_00200679 predicted 1725
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133287 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00267560 predicted 277
2 SASI_Rn01_00088884 predicted 267
3 SASI_Rn01_00088885 predicted 1376
4 SASI_Rn01_00088886 predicted 884
5 SASI_Rn01_00088887 predicted 535
6 SASI_Rn02_00267561 predicted 574
7 SASI_Rn01_00088889 predicted 1007
8 SASI_Rn01_00088890 predicted 717
9 SASI_Rn01_00088891 predicted 1141
10 SASI_Rn01_00088892 predicted 1258
11 SASI_Rn01_00088883 predicted 392
12 SASI_Rn01_00088888 predicted 877
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010949 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00160762 predicted 308
2 SASI_Mm01_00160763 predicted 666
3 SASI_Mm01_00160764 predicted 296
4 SASI_Mm01_00160765 predicted 1418
5 SASI_Mm01_00160766 predicted 1183
6 SASI_Mm01_00160767 predicted 417
7 SASI_Mm02_00319705 predicted 570
8 SASI_Mm01_00160769 predicted 1461
9 SASI_Mm01_00160770 predicted 902
10 SASI_Mm01_00160771 predicted 1200
11 SASI_Mm01_00160768 predicted 890
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010949
VALIDATED
NUMB MISSION shRNA Bacterial Glycerol Stock
numb homolog (Drosophila)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000105735    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010949.1-487s1c1
Sequence:CCGGGCAGCCTGTTTAGAGCGTAAACTCGAGTTTACGCTCTAAACAGGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105737    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010949.1-411s1c1
Sequence:CCGGGCGATGGATCTGTCATTGTTTCTCGAGAAACAATGACAGATCCATCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105739    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010949.1-1534s1c1
Sequence:CCGGCAGCAGACATTCCCTCAATATCTCGAGATATTGAGGGAATGTCTGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105738    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010949.1-851s1c1
Sequence:CCGGGCCAGAAGATGTCACCCTTTACTCGAGTAAAGGGTGACATCTTCTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105736    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010949.1-1184s1c1
Sequence:CCGGGCTGGTTAGAAGAAGTGTCAACTCGAGTTGACACTTCTTCTAACCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327236    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010949.1-851s21c1
Sequence:CCGGGCCAGAAGATGTCACCCTTTACTCGAGTAAAGGGTGACATCTTCTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327235    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010949.1-411s21c1
Sequence:CCGGGCGATGGATCTGTCATTGTTTCTCGAGAAACAATGACAGATCCATCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327233    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010949.1-487s21c1
Sequence:CCGGGCAGCCTGTTTAGAGCGTAAACTCGAGTTTACGCTCTAAACAGGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327309    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010949.1-1184s21c1
Sequence:CCGGGCTGGTTAGAAGAAGTGTCAACTCGAGTTGACACTTCTTCTAACCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000363599    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010949.1-1534s21c1
Sequence:CCGGCAGCAGACATTCCCTCAATATCTCGAGATATTGAGGGAATGTCTGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010949
VALIDATED
NUMB MISSION shRNA shRNA Plasmid DNA
numb homolog (Drosophila)
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000105735    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010949.1-487s1c1
Sequence:CCGGGCAGCCTGTTTAGAGCGTAAACTCGAGTTTACGCTCTAAACAGGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000105737    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010949.1-411s1c1
Sequence:CCGGGCGATGGATCTGTCATTGTTTCTCGAGAAACAATGACAGATCCATCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000105739    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010949.1-1534s1c1
Sequence:CCGGCAGCAGACATTCCCTCAATATCTCGAGATATTGAGGGAATGTCTGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000105738    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010949.1-851s1c1
Sequence:CCGGGCCAGAAGATGTCACCCTTTACTCGAGTAAAGGGTGACATCTTCTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000105736    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010949.1-1184s1c1
Sequence:CCGGGCTGGTTAGAAGAAGTGTCAACTCGAGTTGACACTTCTTCTAACCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000327236    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010949.1-851s21c1
Sequence:CCGGGCCAGAAGATGTCACCCTTTACTCGAGTAAAGGGTGACATCTTCTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000327235    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010949.1-411s21c1
Sequence:CCGGGCGATGGATCTGTCATTGTTTCTCGAGAAACAATGACAGATCCATCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000327233    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010949.1-487s21c1
Sequence:CCGGGCAGCCTGTTTAGAGCGTAAACTCGAGTTTACGCTCTAAACAGGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000327309    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010949.1-1184s21c1
Sequence:CCGGGCTGGTTAGAAGAAGTGTCAACTCGAGTTGACACTTCTTCTAACCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000363599    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010949.1-1534s21c1
Sequence:CCGGCAGCAGACATTCCCTCAATATCTCGAGATATTGAGGGAATGTCTGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010949
VALIDATED
NUMB MISSION shRNA Lentiviral Transduction Particles
numb homolog (Drosophila)
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000105735    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010949.1-487s1c1
Sequence:CCGGGCAGCCTGTTTAGAGCGTAAACTCGAGTTTACGCTCTAAACAGGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105737    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010949.1-411s1c1
Sequence:CCGGGCGATGGATCTGTCATTGTTTCTCGAGAAACAATGACAGATCCATCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105739    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010949.1-1534s1c1
Sequence:CCGGCAGCAGACATTCCCTCAATATCTCGAGATATTGAGGGAATGTCTGCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105738    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010949.1-851s1c1
Sequence:CCGGGCCAGAAGATGTCACCCTTTACTCGAGTAAAGGGTGACATCTTCTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105736    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010949.1-1184s1c1
Sequence:CCGGGCTGGTTAGAAGAAGTGTCAACTCGAGTTGACACTTCTTCTAACCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327236    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010949.1-851s21c1
Sequence:CCGGGCCAGAAGATGTCACCCTTTACTCGAGTAAAGGGTGACATCTTCTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327235    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010949.1-411s21c1
Sequence:CCGGGCGATGGATCTGTCATTGTTTCTCGAGAAACAATGACAGATCCATCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327233    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010949.1-487s21c1
Sequence:CCGGGCAGCCTGTTTAGAGCGTAAACTCGAGTTTACGCTCTAAACAGGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327309    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010949.1-1184s21c1
Sequence:CCGGGCTGGTTAGAAGAAGTGTCAACTCGAGTTGACACTTCTTCTAACCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000363599    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010949.1-1534s21c1
Sequence:CCGGCAGCAGACATTCCCTCAATATCTCGAGATATTGAGGGAATGTCTGCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003744
NUMB MISSION shRNA Bacterial Glycerol Stock
numb homolog (Drosophila)
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000007223    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003744.3-2392s1c1
Sequence:CCGGCCTTGCAATTAGGCTAAAGAACTCGAGTTCTTTAGCCTAATTGCAAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007224    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003744.3-2194s1c1
Sequence:CCGGGCAATCATTATGGCTATGTATCTCGAGATACATAGCCATAATGATTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007226    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003744.3-404s1c1
Sequence:CCGGGCCATGTAGAAGTTGATGAATCTCGAGATTCATCAACTTCTACATGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007227    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003744.3-1672s1c1
Sequence:CCGGGCATCACCTTTCCAAGGGAATCTCGAGATTCCCTTGGAAAGGTGATGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007225    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003744.3-1996s1c1
Sequence:CCGGGCAGCTTTCAATGGTGTAGATCTCGAGATCTACACCATTGAAAGCTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430626    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003744.5-2222s21c1
Sequence:CCGGGACGTTTGAAATTGAACTTTACTCGAGTAAAGTTCAATTTCAAACGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430008    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003744.5-1151s21c1
Sequence:CCGGACCCTTTAAACGCCAACTATCCTCGAGGATAGTTGGCGTTTAAAGGGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429190    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003744.5-1448s21c1
Sequence:CCGGAGCAATGCCTGTGCGTGAAACCTCGAGGTTTCACGCACAGGCATTGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420785    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003744.5-1884s21c1
Sequence:CCGGCAGATGGTGGCCAACGTATTTCTCGAGAAATACGTTGGCCACCATCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003744
NUMB MISSION shRNA shRNA Plasmid DNA
numb homolog (Drosophila)
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000007223    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003744.3-2392s1c1
Sequence:CCGGCCTTGCAATTAGGCTAAAGAACTCGAGTTCTTTAGCCTAATTGCAAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000007224    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003744.3-2194s1c1
Sequence:CCGGGCAATCATTATGGCTATGTATCTCGAGATACATAGCCATAATGATTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000007226    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003744.3-404s1c1
Sequence:CCGGGCCATGTAGAAGTTGATGAATCTCGAGATTCATCAACTTCTACATGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000007227    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003744.3-1672s1c1
Sequence:CCGGGCATCACCTTTCCAAGGGAATCTCGAGATTCCCTTGGAAAGGTGATGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000007225    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003744.3-1996s1c1
Sequence:CCGGGCAGCTTTCAATGGTGTAGATCTCGAGATCTACACCATTGAAAGCTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430626    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003744.5-2222s21c1
Sequence:CCGGGACGTTTGAAATTGAACTTTACTCGAGTAAAGTTCAATTTCAAACGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430008    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003744.5-1151s21c1
Sequence:CCGGACCCTTTAAACGCCAACTATCCTCGAGGATAGTTGGCGTTTAAAGGGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429190    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003744.5-1448s21c1
Sequence:CCGGAGCAATGCCTGTGCGTGAAACCTCGAGGTTTCACGCACAGGCATTGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420785    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003744.5-1884s21c1
Sequence:CCGGCAGATGGTGGCCAACGTATTTCTCGAGAAATACGTTGGCCACCATCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003744
NUMB MISSION shRNA Lentiviral Transduction Particles
numb homolog (Drosophila)
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000007223    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003744.3-2392s1c1
Sequence:CCGGCCTTGCAATTAGGCTAAAGAACTCGAGTTCTTTAGCCTAATTGCAAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007224    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003744.3-2194s1c1
Sequence:CCGGGCAATCATTATGGCTATGTATCTCGAGATACATAGCCATAATGATTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007226    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003744.3-404s1c1
Sequence:CCGGGCCATGTAGAAGTTGATGAATCTCGAGATTCATCAACTTCTACATGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007227    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003744.3-1672s1c1
Sequence:CCGGGCATCACCTTTCCAAGGGAATCTCGAGATTCCCTTGGAAAGGTGATGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007225    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003744.3-1996s1c1
Sequence:CCGGGCAGCTTTCAATGGTGTAGATCTCGAGATCTACACCATTGAAAGCTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430626    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003744.5-2222s21c1
Sequence:CCGGGACGTTTGAAATTGAACTTTACTCGAGTAAAGTTCAATTTCAAACGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430008    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003744.5-1151s21c1
Sequence:CCGGACCCTTTAAACGCCAACTATCCTCGAGGATAGTTGGCGTTTAAAGGGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429190    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003744.5-1448s21c1
Sequence:CCGGAGCAATGCCTGTGCGTGAAACCTCGAGGTTTCACGCACAGGCATTGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420785    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003744.5-1884s21c1
Sequence:CCGGCAGATGGTGGCCAACGTATTTCTCGAGAAATACGTTGGCCACCATCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)