EMAIL THIS PAGE TO A FRIEND

NUP133

nucleoporin 133kDa

55 Gene Product Result for
Synonyms: hNUP133
UniProtKB ID: Q8WUM0, B2RAZ8, Q5T8N0, Q9H9W2, Q9NV71, Q9NVC4
Gene ID:
Human(55746) Summary: The nuclear envelope creates distinct nuclear and cytoplasmic compartments in eukaryotic cells. It consists of two concentric membranes perforated by nuclear pores, large protein complexes that form aqueous channels to regulate the flow of macromolecules between the nucleus and the cytoplasm. These complexes are composed of at least 100 different polypeptide subunits, many of which belong to the nucleoporin family. The nucleoporin protein encoded by this gene displays evolutionarily conserved interactions with other nucleoporins. This protein, which localizes to both sides of the nuclear pore complex at interphase, remains associated with the complex during mitosis and is targeted at early stages to the reforming nuclear envelope. This protein also localizes to kinetochores of mitotic cells. [provided by RefSeq, Jul 2008]
Mouse(234865) nucleoporin 133
Rat(292085) nucleoporin 133
domestic guinea pig(100722458) nucleoporin 133kDa
naked mole-rat(101721025) nucleoporin 133kDa
sheep(101108101) nucleoporin 133kDa
fruit fly(42680) Nucleoporin 133
cow(524528) nucleoporin 133kDa
Horse(100065427) nucleoporin 133kDa
domestic cat(101092546) nucleoporin 133kDa
dog(479208) nucleoporin 133kDa
chicken(421535) nucleoporin 133kDa
Zebrafish(406852) nucleoporin 133
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_172288 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172288 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172288 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_018230 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018230 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018230 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018230 Rosetta Predictions human pricing
XM_001053507 Rosetta Predictions rat pricing
XM_214721 Rosetta Predictions rat pricing
NM_172288 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018230 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00039131 predicted 1176
2 SASI_Hs02_00351550 predicted 297
3 SASI_Hs01_00039134 predicted 2952
4 SASI_Hs01_00039136 predicted 544
5 SASI_Hs02_00351551 predicted 2269
6 SASI_Hs01_00039137 predicted 1762
7 SASI_Hs01_00039138 predicted 3170
8 SASI_Hs01_00039139 predicted 1256
9 SASI_Hs02_00351552 predicted 1084
10 SASI_Hs02_00351553 predicted 589
11 SASI_Hs01_00039132 predicted 1074
12 SASI_Hs01_00039133 predicted 3013
13 SASI_Hs01_00039135 predicted 3372
14 SASI_Hs01_00039140 predicted 711
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001053507 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00272546 predicted 3394
2 SASI_Rn02_00272547 predicted 546
3 SASI_Rn02_00272548 predicted 2431
4 SASI_Rn02_00272549 predicted 1303
5 SASI_Rn02_00272550 predicted 1638
6 SASI_Rn02_00272551 predicted 1188
7 SASI_Rn02_00272552 predicted 1402
8 SASI_Rn02_00272553 predicted 3138
9 SASI_Rn02_00272554 predicted 3366
10 SASI_Rn02_00272555 predicted 344
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_214721 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00145654 predicted 3516
2 SASI_Rn01_00145655 predicted 2561
3 SASI_Rn01_00145656 predicted 1456
4 SASI_Rn01_00145657 predicted 405
5 SASI_Rn01_00145658 predicted 1764
6 SASI_Rn01_00145659 predicted 1346
7 SASI_Rn01_00145660 predicted 1380
8 SASI_Rn01_00145661 predicted 3269
9 SASI_Rn01_00145662 predicted 1684
10 SASI_Rn01_00145663 predicted 2379
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172288 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00153339 predicted 3354
2 SASI_Mm01_00153340 predicted 1235
3 SASI_Mm01_00153341 predicted 3181
4 SASI_Mm01_00153342 predicted 3248
5 SASI_Mm01_00153343 predicted 1309
6 SASI_Mm01_00153344 predicted 3369
7 SASI_Mm01_00153346 predicted 2332
8 SASI_Mm01_00153347 predicted 2926
9 SASI_Mm01_00153348 predicted 216
10 SASI_Mm02_00343773 predicted 1705
11 SASI_Mm01_00153345 predicted 3386
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172288
VALIDATED
NUP133 MISSION shRNA Bacterial Glycerol Stock
nucleoporin 133kDa
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000246816    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_172288.1-2265s21c1
Sequence:CCGGAGGTGGCGATCGACGTCAATACTCGAGTATTGACGTCGATCGCCACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246817    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_172288.1-2504s21c1
Sequence:CCGGGAGCAGCTTGTGGCACTAATTCTCGAGAATTAGTGCCACAAGCTGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194199    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172288.1-2684s1c1
Sequence:CCGGGCAGAGAAGTATTGTGACTTTCTCGAGAAAGTCACAATACTTCTCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246814    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_172288.1-1869s21c1
Sequence:CCGGGCAACACCTCACTGATCATTTCTCGAGAAATGATCAGTGAGGTGTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193761    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172288.1-1339s1c1
Sequence:CCGGCCAGATGACCTATCTTTACATCTCGAGATGTAAAGATAGGTCATCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246818    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172288.1-541s21c1
Sequence:CCGGTTTCCACGGGAGCGCTGATTTCTCGAGAAATCAGCGCTCCCGTGGAAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175799    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172288.1-3195s1c1
Sequence:CCGGGTCTGTATATCTGTGACGAAACTCGAGTTTCGTCACAGATATACAGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246815    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_172288.1-281s21c1
Sequence:CCGGGGAACGCCTACTCGGATATTCCTCGAGGAATATCCGAGTAGGCGTTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172288
VALIDATED
NUP133 MISSION shRNA shRNA Plasmid DNA
nucleoporin 133kDa
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000246816    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_172288.1-2265s21c1
Sequence:CCGGAGGTGGCGATCGACGTCAATACTCGAGTATTGACGTCGATCGCCACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000246817    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_172288.1-2504s21c1
Sequence:CCGGGAGCAGCTTGTGGCACTAATTCTCGAGAATTAGTGCCACAAGCTGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194199    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172288.1-2684s1c1
Sequence:CCGGGCAGAGAAGTATTGTGACTTTCTCGAGAAAGTCACAATACTTCTCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000246814    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_172288.1-1869s21c1
Sequence:CCGGGCAACACCTCACTGATCATTTCTCGAGAAATGATCAGTGAGGTGTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000193761    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172288.1-1339s1c1
Sequence:CCGGCCAGATGACCTATCTTTACATCTCGAGATGTAAAGATAGGTCATCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000246818    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172288.1-541s21c1
Sequence:CCGGTTTCCACGGGAGCGCTGATTTCTCGAGAAATCAGCGCTCCCGTGGAAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000175799    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172288.1-3195s1c1
Sequence:CCGGGTCTGTATATCTGTGACGAAACTCGAGTTTCGTCACAGATATACAGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000246815    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_172288.1-281s21c1
Sequence:CCGGGGAACGCCTACTCGGATATTCCTCGAGGAATATCCGAGTAGGCGTTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172288
VALIDATED
NUP133 MISSION shRNA Lentiviral Transduction Particles
nucleoporin 133kDa
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000246816    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_172288.1-2265s21c1
Sequence:CCGGAGGTGGCGATCGACGTCAATACTCGAGTATTGACGTCGATCGCCACCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000246817    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_172288.1-2504s21c1
Sequence:CCGGGAGCAGCTTGTGGCACTAATTCTCGAGAATTAGTGCCACAAGCTGCTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194199    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172288.1-2684s1c1
Sequence:CCGGGCAGAGAAGTATTGTGACTTTCTCGAGAAAGTCACAATACTTCTCTGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000246814    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_172288.1-1869s21c1
Sequence:CCGGGCAACACCTCACTGATCATTTCTCGAGAAATGATCAGTGAGGTGTTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000193761    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172288.1-1339s1c1
Sequence:CCGGCCAGATGACCTATCTTTACATCTCGAGATGTAAAGATAGGTCATCTGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000246818    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172288.1-541s21c1
Sequence:CCGGTTTCCACGGGAGCGCTGATTTCTCGAGAAATCAGCGCTCCCGTGGAAATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000175799    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172288.1-3195s1c1
Sequence:CCGGGTCTGTATATCTGTGACGAAACTCGAGTTTCGTCACAGATATACAGACTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000246815    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_172288.1-281s21c1
Sequence:CCGGGGAACGCCTACTCGGATATTCCTCGAGGAATATCCGAGTAGGCGTTCCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018230
NUP133 MISSION shRNA Bacterial Glycerol Stock
nucleoporin 133kDa
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000145353    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018230.2-4003s1c1
Sequence:CCGGGCTAATGGGAAATGTCTAGTACTCGAGTACTAGACATTTCCCATTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144112    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018230.2-3177s1c1
Sequence:CCGGCCACAACTCATTGGTCTATATCTCGAGATATAGACCAATGAGTTGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143014    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018230.2-894s1c1
Sequence:CCGGCCTAGTAGTGATCTCACACTTCTCGAGAAGTGTGAGATCACTACTAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143344    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018230.2-2229s1c1
Sequence:CCGGGATGCACCTATGGATTCCATTCTCGAGAATGGAATCCATAGGTGCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145133    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018230.2-703s1c1
Sequence:CCGGGAGGTGATAAGACTTACAGTTCTCGAGAACTGTAAGTCTTATCACCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121986    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018230.2-959s1c1
Sequence:CCGGGACGAGTTCAAACATCAGTAACTCGAGTTACTGATGTTTGAACTCGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142066    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018230.2-3453s1c1
Sequence:CCGGGAGGTGAAAGACCTGCTACAACTCGAGTTGTAGCAGGTCTTTCACCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121583    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018230.2-486s1c1
Sequence:CCGGCCTATTACTAAGTTATCCGTTCTCGAGAACGGATAACTTAGTAATAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121683    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018230.2-3857s1c1
Sequence:CCGGGCTCACATGTACAAATCACTTCTCGAGAAGTGATTTGTACATGTGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018230
NUP133 MISSION shRNA shRNA Plasmid DNA
nucleoporin 133kDa
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000145353    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018230.2-4003s1c1
Sequence:CCGGGCTAATGGGAAATGTCTAGTACTCGAGTACTAGACATTTCCCATTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144112    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018230.2-3177s1c1
Sequence:CCGGCCACAACTCATTGGTCTATATCTCGAGATATAGACCAATGAGTTGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000143014    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018230.2-894s1c1
Sequence:CCGGCCTAGTAGTGATCTCACACTTCTCGAGAAGTGTGAGATCACTACTAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000143344    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018230.2-2229s1c1
Sequence:CCGGGATGCACCTATGGATTCCATTCTCGAGAATGGAATCCATAGGTGCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000145133    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018230.2-703s1c1
Sequence:CCGGGAGGTGATAAGACTTACAGTTCTCGAGAACTGTAAGTCTTATCACCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121986    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018230.2-959s1c1
Sequence:CCGGGACGAGTTCAAACATCAGTAACTCGAGTTACTGATGTTTGAACTCGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142066    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018230.2-3453s1c1
Sequence:CCGGGAGGTGAAAGACCTGCTACAACTCGAGTTGTAGCAGGTCTTTCACCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121583    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018230.2-486s1c1
Sequence:CCGGCCTATTACTAAGTTATCCGTTCTCGAGAACGGATAACTTAGTAATAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121683    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018230.2-3857s1c1
Sequence:CCGGGCTCACATGTACAAATCACTTCTCGAGAAGTGATTTGTACATGTGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018230
NUP133 MISSION shRNA Lentiviral Transduction Particles
nucleoporin 133kDa
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000145353    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018230.2-4003s1c1
Sequence:CCGGGCTAATGGGAAATGTCTAGTACTCGAGTACTAGACATTTCCCATTAGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144112    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018230.2-3177s1c1
Sequence:CCGGCCACAACTCATTGGTCTATATCTCGAGATATAGACCAATGAGTTGTGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000143014    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018230.2-894s1c1
Sequence:CCGGCCTAGTAGTGATCTCACACTTCTCGAGAAGTGTGAGATCACTACTAGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000143344    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018230.2-2229s1c1
Sequence:CCGGGATGCACCTATGGATTCCATTCTCGAGAATGGAATCCATAGGTGCATCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000145133    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018230.2-703s1c1
Sequence:CCGGGAGGTGATAAGACTTACAGTTCTCGAGAACTGTAAGTCTTATCACCTCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121986    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018230.2-959s1c1
Sequence:CCGGGACGAGTTCAAACATCAGTAACTCGAGTTACTGATGTTTGAACTCGTCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142066    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018230.2-3453s1c1
Sequence:CCGGGAGGTGAAAGACCTGCTACAACTCGAGTTGTAGCAGGTCTTTCACCTCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121583    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018230.2-486s1c1
Sequence:CCGGCCTATTACTAAGTTATCCGTTCTCGAGAACGGATAACTTAGTAATAGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121683    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018230.2-3857s1c1
Sequence:CCGGGCTCACATGTACAAATCACTTCTCGAGAAGTGATTTGTACATGTGAGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)