EMAIL THIS PAGE TO A FRIEND

NUP153

nucleoporin 153kDa

129 Gene Product Result for
Synonyms: HNUP153 N153
UniProtKB ID: P49790, Q5T9I7
Gene ID:
Human(9972) Summary: Nuclear pore complexes regulate the transport of macromolecules between the nucleus and cytoplasm. They are composed of at least 100 different polypeptide subunits, many of which belong to the nucleoporin family. Nucleoporins are glycoproteins found in nuclear pores and contain characteristic pentapeptide XFXFG repeats as well as O-linked N-acetylglucosamine residues oriented towards the cytoplasm. The protein encoded by this gene has three distinct domains: a N-terminal region containing a pore targeting and an RNA-binding domain domain, a central region containing multiple zinc finger motifs, and a C-terminal region containing multiple XFXFG repeats. Alternative splicing results in multiple transcript variants of this gene. [provided by RefSeq, May 2013]
Mouse(218210) nucleoporin 153
Rat(25281) nucleoporin 153
fruit fly(32630) Nucleoporin 153
Zebrafish(571621) nucleoporin 153kDa
chicken(420848) nucleoporin 153kDa
dog(478732) nucleoporin 153kDa
cow(513270) nucleoporin 153kDa
Horse(100066078) nucleoporin 153kDa
domestic cat(101100133) nucleoporin 153kDa
Zebrafish(325856) nucleoporin 153
sheep(101123671) nucleoporin 153kDa
naked mole-rat(101706615) nucleoporin 153kDa
Domestic Rabbit(100341571) nucleoporin 153kDa
domestic guinea pig(100721240) nucleoporin 153kDa
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005124 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005124 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005124 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_175749 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175749 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175749 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005124 Rosetta Predictions human pricing
NM_001100470 Rosetta Predictions rat pricing
NM_175749 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005124 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00140617 predicted 2379
2 SASI_Hs01_00140619 predicted 3422
3 SASI_Hs01_00140620 predicted 1076
4 SASI_Hs01_00140621 predicted 2217
5 SASI_Hs01_00140622 predicted 1016
6 SASI_Hs01_00140623 predicted 4346
7 SASI_Hs01_00140624 predicted 661
8 SASI_Hs02_00339035 predicted 3004
9 SASI_Hs01_00140626 predicted 4362
10 SASI_Hs02_00339036 predicted 2621
11 SASI_Hs01_00140618 predicted 2504
12 SASI_Hs01_00140625 predicted 3528
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001100470 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00209844 predicted 1717
2 SASI_Rn02_00209845 predicted 1260
3 SASI_Rn02_00209846 predicted 890
4 SASI_Rn02_00209847 predicted 700
5 SASI_Rn02_00209848 predicted 2713
6 SASI_Rn02_00209849 predicted 1464
7 SASI_Rn02_00209850 predicted 4544
8 SASI_Rn02_00209851 predicted 938
9 SASI_Rn02_00209852 predicted 2419
10 SASI_Rn02_00209853 predicted 3878
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175749 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00133193 predicted 2731
2 SASI_Mm01_00133194 predicted 1042
3 SASI_Mm01_00133195 predicted 2274
4 SASI_Mm01_00133196 predicted 4231
5 SASI_Mm01_00133197 predicted 462
6 SASI_Mm01_00133198 predicted 2208
7 SASI_Mm01_00133199 predicted 2253
8 SASI_Mm01_00133200 predicted 1027
9 SASI_Mm02_00346652 predicted 2652
10 SASI_Mm01_00133201 predicted 1535
11 SASI_Mm01_00133202 predicted 3956
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005124
VALIDATED
NUP153 MISSION shRNA Bacterial Glycerol Stock
nucleoporin 153kDa
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000060243    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005124.2-2469s1c1
Sequence:CCGGGCCCTTACATTGACAGTGGTTCTCGAGAACCACTGTCAATGTAAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060245    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005124.2-4593s1c1
Sequence:CCGGCGCAAGATAAAGACTGCTGTTCTCGAGAACAGCAGTCTTTATCTTGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060244    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_005124.2-362s1c1
Sequence:CCGGGCTACAAAGATACTTCAACAACTCGAGTTGTTGAAGTATCTTTGTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060247    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_005124.2-3173s1c1
Sequence:CCGGCCCAGTTTCTTTAACTCCATTCTCGAGAATGGAGTTAAAGAAACTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060246    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005124.2-1690s1c1
Sequence:CCGGCCTCTCCATCACCCATCAATTCTCGAGAATTGATGGGTGATGGAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290594    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_005124.2-3173s21c1
Sequence:CCGGCCCAGTTTCTTTAACTCCATTCTCGAGAATGGAGTTAAAGAAACTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296548    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005124.2-3011s21c1
Sequence:CCGGATCTGATTCTGGGTCTATAAACTCGAGTTTATAGACCCAGAATCAGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296547    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_005124.2-3816s21c1
Sequence:CCGGTCTGCTGGTGGTGGCATATTTCTCGAGAAATATGCCACCACCAGCAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296605    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005124.2-1021s21c1
Sequence:CCGGGACAGTCTAAACTACGAAATACTCGAGTATTTCGTAGTTTAGACTGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308266    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_005124.2-4635s21c1
Sequence:CCGGCATTGGTGTTGTACTCAATTTCTCGAGAAATTGAGTACAACACCAATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005124
VALIDATED
NUP153 MISSION shRNA shRNA Plasmid DNA
nucleoporin 153kDa
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000060243    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005124.2-2469s1c1
Sequence:CCGGGCCCTTACATTGACAGTGGTTCTCGAGAACCACTGTCAATGTAAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060245    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005124.2-4593s1c1
Sequence:CCGGCGCAAGATAAAGACTGCTGTTCTCGAGAACAGCAGTCTTTATCTTGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060244    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_005124.2-362s1c1
Sequence:CCGGGCTACAAAGATACTTCAACAACTCGAGTTGTTGAAGTATCTTTGTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060247    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_005124.2-3173s1c1
Sequence:CCGGCCCAGTTTCTTTAACTCCATTCTCGAGAATGGAGTTAAAGAAACTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060246    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005124.2-1690s1c1
Sequence:CCGGCCTCTCCATCACCCATCAATTCTCGAGAATTGATGGGTGATGGAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000290594    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_005124.2-3173s21c1
Sequence:CCGGCCCAGTTTCTTTAACTCCATTCTCGAGAATGGAGTTAAAGAAACTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000296548    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005124.2-3011s21c1
Sequence:CCGGATCTGATTCTGGGTCTATAAACTCGAGTTTATAGACCCAGAATCAGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000296547    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_005124.2-3816s21c1
Sequence:CCGGTCTGCTGGTGGTGGCATATTTCTCGAGAAATATGCCACCACCAGCAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000296605    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005124.2-1021s21c1
Sequence:CCGGGACAGTCTAAACTACGAAATACTCGAGTATTTCGTAGTTTAGACTGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000308266    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_005124.2-4635s21c1
Sequence:CCGGCATTGGTGTTGTACTCAATTTCTCGAGAAATTGAGTACAACACCAATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005124
VALIDATED
NUP153 MISSION shRNA Lentiviral Transduction Particles
nucleoporin 153kDa
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000060243    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005124.2-2469s1c1
Sequence:CCGGGCCCTTACATTGACAGTGGTTCTCGAGAACCACTGTCAATGTAAGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060245    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005124.2-4593s1c1
Sequence:CCGGCGCAAGATAAAGACTGCTGTTCTCGAGAACAGCAGTCTTTATCTTGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060244    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_005124.2-362s1c1
Sequence:CCGGGCTACAAAGATACTTCAACAACTCGAGTTGTTGAAGTATCTTTGTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060247    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_005124.2-3173s1c1
Sequence:CCGGCCCAGTTTCTTTAACTCCATTCTCGAGAATGGAGTTAAAGAAACTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060246    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005124.2-1690s1c1
Sequence:CCGGCCTCTCCATCACCCATCAATTCTCGAGAATTGATGGGTGATGGAGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290594    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_005124.2-3173s21c1
Sequence:CCGGCCCAGTTTCTTTAACTCCATTCTCGAGAATGGAGTTAAAGAAACTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296548    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005124.2-3011s21c1
Sequence:CCGGATCTGATTCTGGGTCTATAAACTCGAGTTTATAGACCCAGAATCAGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296547    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_005124.2-3816s21c1
Sequence:CCGGTCTGCTGGTGGTGGCATATTTCTCGAGAAATATGCCACCACCAGCAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296605    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005124.2-1021s21c1
Sequence:CCGGGACAGTCTAAACTACGAAATACTCGAGTATTTCGTAGTTTAGACTGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308266    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_005124.2-4635s21c1
Sequence:CCGGCATTGGTGTTGTACTCAATTTCTCGAGAAATTGAGTACAACACCAATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175749
VALIDATED
NUP153 MISSION shRNA Bacterial Glycerol Stock
nucleoporin 153kDa
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000102399    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175749.1-3914s1c1
Sequence:CCGGCCAGCAGTAATAGTGTGTCTTCTCGAGAAGACACACTATTACTGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102395    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175749.1-4796s1c1
Sequence:CCGGGCACGGTGAATGGCTTTGTATCTCGAGATACAAAGCCATTCACCGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102398    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_175749.1-2692s1c1
Sequence:CCGGGCCAAGTGCATAGCTTGTGAACTCGAGTTCACAAGCTATGCACTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102397    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175749.1-1840s1c1
Sequence:CCGGGCAGTGAATAGTTCAAGCTATCTCGAGATAGCTTGAACTATTCACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102396    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175749.1-433s1c1
Sequence:CCGGGCAGGCAGTAACACAGAAGAACTCGAGTTCTTCTGTGTTACTGCCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319466    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175749.1-4036s21c1
Sequence:CCGGGCTAACCAGACTCCAACATTTCTCGAGAAATGTTGGAGTCTGGTTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317651    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175749.1-2692s21c1
Sequence:CCGGGCCAAGTGCATAGCTTGTGAACTCGAGTTCACAAGCTATGCACTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319538    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_175749.1-3694s21c1
Sequence:CCGGTCATCTAGTGGTGGCATATTTCTCGAGAAATATGCCACCACTAGATGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319468    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_175749.1-4917s21c1
Sequence:CCGGTAGATTAGAGGACGTTGAAATCTCGAGATTTCAACGTCCTCTAATCTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319467    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175749.1-4266s21c1
Sequence:CCGGTGGTAGCAGCACTACGAATTTCTCGAGAAATTCGTAGTGCTGCTACCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175749
VALIDATED
NUP153 MISSION shRNA shRNA Plasmid DNA
nucleoporin 153kDa
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000102399    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175749.1-3914s1c1
Sequence:CCGGCCAGCAGTAATAGTGTGTCTTCTCGAGAAGACACACTATTACTGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102395    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175749.1-4796s1c1
Sequence:CCGGGCACGGTGAATGGCTTTGTATCTCGAGATACAAAGCCATTCACCGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102398    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_175749.1-2692s1c1
Sequence:CCGGGCCAAGTGCATAGCTTGTGAACTCGAGTTCACAAGCTATGCACTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102397    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175749.1-1840s1c1
Sequence:CCGGGCAGTGAATAGTTCAAGCTATCTCGAGATAGCTTGAACTATTCACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102396    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175749.1-433s1c1
Sequence:CCGGGCAGGCAGTAACACAGAAGAACTCGAGTTCTTCTGTGTTACTGCCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000319466    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175749.1-4036s21c1
Sequence:CCGGGCTAACCAGACTCCAACATTTCTCGAGAAATGTTGGAGTCTGGTTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000317651    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175749.1-2692s21c1
Sequence:CCGGGCCAAGTGCATAGCTTGTGAACTCGAGTTCACAAGCTATGCACTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000319538    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_175749.1-3694s21c1
Sequence:CCGGTCATCTAGTGGTGGCATATTTCTCGAGAAATATGCCACCACTAGATGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000319468    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_175749.1-4917s21c1
Sequence:CCGGTAGATTAGAGGACGTTGAAATCTCGAGATTTCAACGTCCTCTAATCTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000319467    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175749.1-4266s21c1
Sequence:CCGGTGGTAGCAGCACTACGAATTTCTCGAGAAATTCGTAGTGCTGCTACCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175749
VALIDATED
NUP153 MISSION shRNA Lentiviral Transduction Particles
nucleoporin 153kDa
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000102399    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175749.1-3914s1c1
Sequence:CCGGCCAGCAGTAATAGTGTGTCTTCTCGAGAAGACACACTATTACTGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102395    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175749.1-4796s1c1
Sequence:CCGGGCACGGTGAATGGCTTTGTATCTCGAGATACAAAGCCATTCACCGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102398    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_175749.1-2692s1c1
Sequence:CCGGGCCAAGTGCATAGCTTGTGAACTCGAGTTCACAAGCTATGCACTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102397    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175749.1-1840s1c1
Sequence:CCGGGCAGTGAATAGTTCAAGCTATCTCGAGATAGCTTGAACTATTCACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102396    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175749.1-433s1c1
Sequence:CCGGGCAGGCAGTAACACAGAAGAACTCGAGTTCTTCTGTGTTACTGCCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319466    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175749.1-4036s21c1
Sequence:CCGGGCTAACCAGACTCCAACATTTCTCGAGAAATGTTGGAGTCTGGTTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317651    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175749.1-2692s21c1
Sequence:CCGGGCCAAGTGCATAGCTTGTGAACTCGAGTTCACAAGCTATGCACTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319538    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_175749.1-3694s21c1
Sequence:CCGGTCATCTAGTGGTGGCATATTTCTCGAGAAATATGCCACCACTAGATGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319468    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_175749.1-4917s21c1
Sequence:CCGGTAGATTAGAGGACGTTGAAATCTCGAGATTTCAACGTCCTCTAATCTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319467    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175749.1-4266s21c1
Sequence:CCGGTGGTAGCAGCACTACGAATTTCTCGAGAAATTCGTAGTGCTGCTACCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)