EMAIL THIS PAGE TO A FRIEND

NUP155

nucleoporin 155kDa

74 Gene Product Result for
Synonyms: N155
UniProtKB ID: O75694, Q9UBE9, Q9UFL5
Gene ID:
Human(9631) Summary: Nucleoporins are proteins that play an important role in the assembly and functioning of the nuclear pore complex (NPC) which regulates the movement of macromolecules across the nuclear envelope (NE). The protein encoded by this gene plays a role in the fusion of NE vesicles and formation of the double membrane NE. The protein may also be involved in cardiac physiology and may be associated with the pathogenesis of atrial fibrillation. Alternative splicing results in multiple transcript variants of this gene. A pseudogene associated with this gene is located on chromosome 6. [provided by RefSeq, May 2013]
Mouse(170762) nucleoporin 155
Rat(117021) nucleoporin 155
Thale Cress(838050) nucleoporin 155
cow(506738) nucleoporin 155kDa
Horse(100053405) nucleoporin 155kDa
domestic cat(101096702) nucleoporin 155kDa
dog(479360) nucleoporin 155kDa
chicken(427443) nucleoporin 155kDa
Zebrafish(393125) nucleoporin 155
domestic guinea pig(100717557) nucleoporin 155kDa
Domestic Rabbit(100347238) nucleoporin 155kDa
naked mole-rat(101701623) nucleoporin 155kDa
sheep(101107818) nucleoporin 155kDa
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_133227 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_133227 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_133227 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004298 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004298 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004298 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004298 Rosetta Predictions human pricing
NM_153485 Rosetta Predictions human pricing
NM_053952 Rosetta Predictions rat pricing
NM_133227 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004298 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00337312 predicted 1899
2 SASI_Hs01_00099672 predicted 2499
3 SASI_Hs02_00337313 predicted 1102
4 SASI_Hs01_00099674 predicted 496
5 SASI_Hs02_00337314 predicted 861
6 SASI_Hs01_00099675 predicted 422
7 SASI_Hs01_00099677 predicted 3197
8 SASI_Hs02_00337315 predicted 1305
9 SASI_Hs01_00099680 predicted 2037
10 SASI_Hs02_00337316 predicted 3047
11 SASI_Hs01_00099671 predicted 3447
12 SASI_Hs01_00099673 predicted 3683
13 SASI_Hs01_00099676 predicted 2543
14 SASI_Hs01_00099678 predicted 3111
15 SASI_Hs01_00099679 predicted 2340
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153485 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00367306 predicted 2047
2 SASI_Hs01_00084175 predicted 2655
3 SASI_Hs02_00367307 predicted 1258
4 SASI_Hs01_00084177 predicted 648
5 SASI_Hs02_00367308 predicted 1019
6 SASI_Hs01_00084178 predicted 578
7 SASI_Hs01_00084180 predicted 3347
8 SASI_Hs02_00367309 predicted 1460
9 SASI_Hs01_00084183 predicted 2188
10 SASI_Hs02_00367310 predicted 3200
11 SASI_Hs01_00084174 predicted 3603
12 SASI_Hs01_00084176 predicted 3829
13 SASI_Hs01_00084179 predicted 2701
14 SASI_Hs01_00084181 predicted 3259
15 SASI_Hs01_00084182 predicted 2497
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053952 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00093173 predicted 3090
2 SASI_Rn01_00093174 predicted 2082
3 SASI_Rn01_00093175 predicted 1199
4 SASI_Rn01_00093176 predicted 1062
5 SASI_Rn01_00093177 predicted 1589
6 SASI_Rn02_00266915 predicted 3666
7 SASI_Rn01_00093178 predicted 2573
8 SASI_Rn01_00093180 predicted 3954
9 SASI_Rn01_00093181 predicted 3297
10 SASI_Rn01_00093182 predicted 3153
11 SASI_Rn01_00093179 predicted 3763
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133227 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00077206 predicted 1258
2 SASI_Mm01_00077207 predicted 3149
3 SASI_Mm01_00077209 predicted 1151
4 SASI_Mm01_00077210 predicted 660
5 SASI_Mm01_00077211 predicted 3040
6 SASI_Mm02_00338459 predicted 611
7 SASI_Mm01_00077213 predicted 363
8 SASI_Mm01_00077214 predicted 1126
9 SASI_Mm02_00338460 predicted 1660
10 SASI_Mm02_00338461 predicted 3702
11 SASI_Mm01_00077205 predicted 4165
12 SASI_Mm01_00077208 predicted 4185
13 SASI_Mm01_00077212 predicted 1129
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133227
VALIDATED
NUP155 MISSION shRNA Bacterial Glycerol Stock
nucleoporin 155kDa
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000327181    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133227.3-3949s21c1
Sequence:CCGGGCAGCAAGTTTGTACCTTAAACTCGAGTTTAAGGTACAAACTTGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306643    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133227.3-485s21c1
Sequence:CCGGACGATTGACAGTGACATATTCCTCGAGGAATATGTCACTGTCAATCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311582    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133227.3-4497s21c1
Sequence:CCGGTGATAAGTTGGGCCCAGATATCTCGAGATATCTGGGCCCAACTTATCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306645    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133227.3-3704s21c1
Sequence:CCGGGAATTTGCTGACCCGTTTAAACTCGAGTTTAAACGGGTCAGCAAATTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306580    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133227.3-1013s21c1
Sequence:CCGGCGATCGGAGAAAGGAGTTATACTCGAGTATAACTCCTTTCTCCGATCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091253    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133227.2-4837s1c1
Sequence:CCGGCCTTAGTGCTAGATTCTGTAACTCGAGTTACAGAATCTAGCACTAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091257    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133227.2-2278s1c1
Sequence:CCGGCCCTGGGAAATCCAAATACTACTCGAGTAGTATTTGGATTTCCCAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091256    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133227.2-3902s1c1
Sequence:CCGGGCAGCAAGTTTGTACCTTAAACTCGAGTTTAAGGTACAAACTTGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091255    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133227.2-3231s1c1
Sequence:CCGGGCAGATAAACTGCTACAGATTCTCGAGAATCTGTAGCAGTTTATCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091254    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133227.2-1175s1c1
Sequence:CCGGCGCAGGTGTAAGGCTGTATTTCTCGAGAAATACAGCCTTACACCTGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133227
VALIDATED
NUP155 MISSION shRNA shRNA Plasmid DNA
nucleoporin 155kDa
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000327181    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133227.3-3949s21c1
Sequence:CCGGGCAGCAAGTTTGTACCTTAAACTCGAGTTTAAGGTACAAACTTGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000306643    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133227.3-485s21c1
Sequence:CCGGACGATTGACAGTGACATATTCCTCGAGGAATATGTCACTGTCAATCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000311582    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133227.3-4497s21c1
Sequence:CCGGTGATAAGTTGGGCCCAGATATCTCGAGATATCTGGGCCCAACTTATCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000306645    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133227.3-3704s21c1
Sequence:CCGGGAATTTGCTGACCCGTTTAAACTCGAGTTTAAACGGGTCAGCAAATTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000306580    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133227.3-1013s21c1
Sequence:CCGGCGATCGGAGAAAGGAGTTATACTCGAGTATAACTCCTTTCTCCGATCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091253    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133227.2-4837s1c1
Sequence:CCGGCCTTAGTGCTAGATTCTGTAACTCGAGTTACAGAATCTAGCACTAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091257    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133227.2-2278s1c1
Sequence:CCGGCCCTGGGAAATCCAAATACTACTCGAGTAGTATTTGGATTTCCCAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091256    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133227.2-3902s1c1
Sequence:CCGGGCAGCAAGTTTGTACCTTAAACTCGAGTTTAAGGTACAAACTTGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091255    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133227.2-3231s1c1
Sequence:CCGGGCAGATAAACTGCTACAGATTCTCGAGAATCTGTAGCAGTTTATCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091254    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133227.2-1175s1c1
Sequence:CCGGCGCAGGTGTAAGGCTGTATTTCTCGAGAAATACAGCCTTACACCTGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133227
VALIDATED
NUP155 MISSION shRNA Lentiviral Transduction Particles
nucleoporin 155kDa
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000327181    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133227.3-3949s21c1
Sequence:CCGGGCAGCAAGTTTGTACCTTAAACTCGAGTTTAAGGTACAAACTTGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306643    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133227.3-485s21c1
Sequence:CCGGACGATTGACAGTGACATATTCCTCGAGGAATATGTCACTGTCAATCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311582    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133227.3-4497s21c1
Sequence:CCGGTGATAAGTTGGGCCCAGATATCTCGAGATATCTGGGCCCAACTTATCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306645    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133227.3-3704s21c1
Sequence:CCGGGAATTTGCTGACCCGTTTAAACTCGAGTTTAAACGGGTCAGCAAATTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306580    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133227.3-1013s21c1
Sequence:CCGGCGATCGGAGAAAGGAGTTATACTCGAGTATAACTCCTTTCTCCGATCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091253    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133227.2-4837s1c1
Sequence:CCGGCCTTAGTGCTAGATTCTGTAACTCGAGTTACAGAATCTAGCACTAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091257    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133227.2-2278s1c1
Sequence:CCGGCCCTGGGAAATCCAAATACTACTCGAGTAGTATTTGGATTTCCCAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091256    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133227.2-3902s1c1
Sequence:CCGGGCAGCAAGTTTGTACCTTAAACTCGAGTTTAAGGTACAAACTTGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091255    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133227.2-3231s1c1
Sequence:CCGGGCAGATAAACTGCTACAGATTCTCGAGAATCTGTAGCAGTTTATCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091254    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133227.2-1175s1c1
Sequence:CCGGCGCAGGTGTAAGGCTGTATTTCTCGAGAAATACAGCCTTACACCTGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004298
VALIDATED
NUP155 MISSION shRNA Bacterial Glycerol Stock
nucleoporin 155kDa
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000229898    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004298.2-314s21c1
Sequence:CCGGCACAATTGACAGTGATATATTCTCGAGAATATATCACTGTCAATTGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218514    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_004298.2-1050s21c1
Sequence:GTACCGGCATGCAGGTGTTAGGTTATATCTCGAGATATAACCTAACACCTGCATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229901    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_004298.2-3590s21c1
Sequence:CCGGCGGTTATTCAGACCCTATATTCTCGAGAATATAGGGTCTGAATAACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229900    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_004298.2-3197s21c1
Sequence:CCGGGGATTTACTCTGGCGGTATTACTCGAGTAATACCGCCAGAGTAAATCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229899    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004298.2-2563s21c1
Sequence:CCGGATAGCACTGATGATGCAATTTCTCGAGAAATTGCATCATCAGTGCTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059913    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A3
TRC Version: 1 Clone ID:NM_004298.2-3589s1c1
Sequence:CCGGCCGGTTATTCAGACCCTATATCTCGAGATATAGGGTCTGAATAACCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059914    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A3
TRC Version: 1 Clone ID:NM_004298.2-3062s1c1
Sequence:CCGGGCTCTTTAGTATTGCCCTTTACTCGAGTAAAGGGCAATACTAAAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059916    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004298.2-423s1c1
Sequence:CCGGGCAGGCATCTTTCAACCTCATCTCGAGATGAGGTTGAAAGATGCCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059917    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_004298.2-3321s1c1
Sequence:CCGGCGAGCCATTCTTAGTGCCAAACTCGAGTTTGGCACTAAGAATGGCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059915    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_004298.2-1800s1c1
Sequence:CCGGCCCTATCCAAATCCATCCTTTCTCGAGAAAGGATGGATTTGGATAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004298
VALIDATED
NUP155 MISSION shRNA shRNA Plasmid DNA
nucleoporin 155kDa
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000229898    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004298.2-314s21c1
Sequence:CCGGCACAATTGACAGTGATATATTCTCGAGAATATATCACTGTCAATTGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000218514    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_004298.2-1050s21c1
Sequence:GTACCGGCATGCAGGTGTTAGGTTATATCTCGAGATATAACCTAACACCTGCATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000229901    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_004298.2-3590s21c1
Sequence:CCGGCGGTTATTCAGACCCTATATTCTCGAGAATATAGGGTCTGAATAACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000229900    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_004298.2-3197s21c1
Sequence:CCGGGGATTTACTCTGGCGGTATTACTCGAGTAATACCGCCAGAGTAAATCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000229899    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004298.2-2563s21c1
Sequence:CCGGATAGCACTGATGATGCAATTTCTCGAGAAATTGCATCATCAGTGCTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059913    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A3
TRC Version: 1 Clone ID:NM_004298.2-3589s1c1
Sequence:CCGGCCGGTTATTCAGACCCTATATCTCGAGATATAGGGTCTGAATAACCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059914    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A3
TRC Version: 1 Clone ID:NM_004298.2-3062s1c1
Sequence:CCGGGCTCTTTAGTATTGCCCTTTACTCGAGTAAAGGGCAATACTAAAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059916    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004298.2-423s1c1
Sequence:CCGGGCAGGCATCTTTCAACCTCATCTCGAGATGAGGTTGAAAGATGCCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059917    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_004298.2-3321s1c1
Sequence:CCGGCGAGCCATTCTTAGTGCCAAACTCGAGTTTGGCACTAAGAATGGCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059915    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_004298.2-1800s1c1
Sequence:CCGGCCCTATCCAAATCCATCCTTTCTCGAGAAAGGATGGATTTGGATAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004298
VALIDATED
NUP155 MISSION shRNA Lentiviral Transduction Particles
nucleoporin 155kDa
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000229898    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004298.2-314s21c1
Sequence:CCGGCACAATTGACAGTGATATATTCTCGAGAATATATCACTGTCAATTGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218514    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_004298.2-1050s21c1
Sequence:GTACCGGCATGCAGGTGTTAGGTTATATCTCGAGATATAACCTAACACCTGCATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229901    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_004298.2-3590s21c1
Sequence:CCGGCGGTTATTCAGACCCTATATTCTCGAGAATATAGGGTCTGAATAACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229900    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_004298.2-3197s21c1
Sequence:CCGGGGATTTACTCTGGCGGTATTACTCGAGTAATACCGCCAGAGTAAATCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229899    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004298.2-2563s21c1
Sequence:CCGGATAGCACTGATGATGCAATTTCTCGAGAAATTGCATCATCAGTGCTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059913    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A3
TRC Version: 1 Clone ID:NM_004298.2-3589s1c1
Sequence:CCGGCCGGTTATTCAGACCCTATATCTCGAGATATAGGGTCTGAATAACCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059914    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A3
TRC Version: 1 Clone ID:NM_004298.2-3062s1c1
Sequence:CCGGGCTCTTTAGTATTGCCCTTTACTCGAGTAAAGGGCAATACTAAAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059916    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004298.2-423s1c1
Sequence:CCGGGCAGGCATCTTTCAACCTCATCTCGAGATGAGGTTGAAAGATGCCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059917    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_004298.2-3321s1c1
Sequence:CCGGCGAGCCATTCTTAGTGCCAAACTCGAGTTTGGCACTAAGAATGGCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059915    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_004298.2-1800s1c1
Sequence:CCGGCCCTATCCAAATCCATCCTTTCTCGAGAAAGGATGGATTTGGATAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)