EMAIL THIS PAGE TO A FRIEND

NUP188

nucleoporin 188kDa

64 Gene Product Result for
Synonyms: KIAA0169 hNup188
UniProtKB ID: Q5SRE5, Q14675, Q2TA87, Q7Z3K8, Q8IWF1
Gene ID:
Human(23511) Summary: The nuclear pore complex (NPC) is found on the nuclear envelope and forms a gateway that regulates the flow of proteins and RNAs between the cytoplasm and nucleoplasm. The NPC is comprised of approximately 30 distinct proteins collectively known as nucleoporins. Nucleoporins are pore-complex-specific glycoproteins which often have cytoplasmically oriented O-linked N-acetylglucosamine residues and numerous repeats of the pentapeptide sequence XFXFG. However, the nucleoporin protein encoded by this gene does not contain the typical FG repeat sequences found in most vertebrate nucleoporins. This nucleoporin is thought to form part of the scaffold for the central channel of the nuclear pore. [provided by RefSeq, Jan 2013]
Mouse(227699) nucleoporin 188
Rat(366016) nucleoporin 188
Zebrafish(559225) nucleoporin 188
chicken(417198) nucleoporin 188kDa
dog(491307) nucleoporin 188kDa
domestic cat(101094303) nucleoporin 188kDa
cow(504307) nucleoporin 188kDa
Horse(100070114) nucleoporin 188kDa
domestic guinea pig(100712923) nucleoporin 188kDa
naked mole-rat(101711408) nucleoporin 188kDa
sheep(101116552) nucleoporin 188kDa
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_198304 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_198304 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_198304 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_015354 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015354 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015354 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015354 Rosetta Predictions human pricing
XM_001077334 Rosetta Predictions rat pricing
XM_345335 Rosetta Predictions rat pricing
NM_198304 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015354 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00079300 predicted 4500
2 SASI_Hs02_00347679 predicted 1635
3 SASI_Hs01_00079302 predicted 1906
4 SASI_Hs01_00079303 predicted 2539
5 SASI_Hs01_00079304 predicted 1856
6 SASI_Hs01_00079305 predicted 1719
7 SASI_Hs01_00079306 predicted 1841
8 SASI_Hs02_00347680 predicted 1213
9 SASI_Hs02_00347681 predicted 4740
10 SASI_Hs01_00079309 predicted 4303
11 SASI_Hs01_00079301 predicted 3153
12 SASI_Hs01_00079307 predicted 940
13 SASI_Hs01_00079308 predicted 1413
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001077334 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00356682 predicted 4775
2 SASI_Rn02_00356683 predicted 1853
3 SASI_Rn02_00356684 predicted 481
4 SASI_Rn02_00356685 predicted 385
5 SASI_Rn02_00356686 predicted 440
6 SASI_Rn02_00356687 predicted 1712
7 SASI_Rn02_00356688 predicted 4364
8 SASI_Rn02_00356689 predicted 3443
9 SASI_Rn02_00356690 predicted 1544
10 SASI_Rn02_00356691 predicted 3171
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_345335 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00398235 predicted 4775
2 SASI_Rn02_00398236 predicted 1861
3 SASI_Rn02_00398237 predicted 486
4 SASI_Rn02_00398238 predicted 236
5 SASI_Rn02_00398239 predicted 378
6 SASI_Rn02_00398240 predicted 433
7 SASI_Rn02_00398241 predicted 1713
8 SASI_Rn02_00398242 predicted 4360
9 SASI_Rn02_00398243 predicted 3444
10 SASI_Rn02_00398244 predicted 1544
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198304 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00198338 predicted 3138
2 SASI_Mm01_00198339 predicted 274
3 SASI_Mm01_00198340 predicted 234
4 SASI_Mm01_00198341 predicted 2545
5 SASI_Mm01_00198342 predicted 1289
6 SASI_Mm01_00198343 predicted 2118
7 SASI_Mm01_00198344 predicted 467
8 SASI_Mm01_00198345 predicted 419
9 SASI_Mm01_00198346 predicted 453
10 SASI_Mm01_00198347 predicted 5243
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198304
VALIDATED
NUP188 MISSION shRNA Bacterial Glycerol Stock
nucleoporin 188kDa
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000374827    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_198304.2-4957s21c1
Sequence:CCGGGCAGAAGGGACCCGAACATTACTCGAGTAATGTTCGGGTCCCTTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178572    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_198304.2-1946s1c1
Sequence:CCGGCCAACATGACTCAGATGATTACTCGAGTAATCATCTGAGTCATGTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198361    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198304.2-103s1c1
Sequence:CCGGGAGGCGGAACTGAATAAATATCTCGAGATATTTATTCAGTTCCGCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198628    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_198304.2-3240s1c1
Sequence:CCGGCGTCAAGTCTTTGGCAGTTTACTCGAGTAAACTGCCAAAGACTTGACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328273    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_198304.2-4229s21c1
Sequence:CCGGTCAAGACTCTACGCTACAATTCTCGAGAATTGTAGCGTAGAGTCTTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328343    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_198304.2-5400s21c1
Sequence:CCGGTGCCCACCCGCTGACATTATTCTCGAGAATAATGTCAGCGGGTGGGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328341    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_198304.2-1706s21c1
Sequence:CCGGCCATCATTGATTTGGTTCATACTCGAGTATGAACCAAATCAATGATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328342    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_198304.2-1946s21c1
Sequence:CCGGCCAACATGACTCAGATGATTACTCGAGTAATCATCTGAGTCATGTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197621    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_198304.2-1706s1c1
Sequence:CCGGCCATCATTGATTTGGTTCATACTCGAGTATGAACCAAATCAATGATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198304
VALIDATED
NUP188 MISSION shRNA shRNA Plasmid DNA
nucleoporin 188kDa
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000374827    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_198304.2-4957s21c1
Sequence:CCGGGCAGAAGGGACCCGAACATTACTCGAGTAATGTTCGGGTCCCTTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000178572    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_198304.2-1946s1c1
Sequence:CCGGCCAACATGACTCAGATGATTACTCGAGTAATCATCTGAGTCATGTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000198361    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198304.2-103s1c1
Sequence:CCGGGAGGCGGAACTGAATAAATATCTCGAGATATTTATTCAGTTCCGCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000198628    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_198304.2-3240s1c1
Sequence:CCGGCGTCAAGTCTTTGGCAGTTTACTCGAGTAAACTGCCAAAGACTTGACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000328273    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_198304.2-4229s21c1
Sequence:CCGGTCAAGACTCTACGCTACAATTCTCGAGAATTGTAGCGTAGAGTCTTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000328343    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_198304.2-5400s21c1
Sequence:CCGGTGCCCACCCGCTGACATTATTCTCGAGAATAATGTCAGCGGGTGGGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000328341    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_198304.2-1706s21c1
Sequence:CCGGCCATCATTGATTTGGTTCATACTCGAGTATGAACCAAATCAATGATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000328342    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_198304.2-1946s21c1
Sequence:CCGGCCAACATGACTCAGATGATTACTCGAGTAATCATCTGAGTCATGTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000197621    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_198304.2-1706s1c1
Sequence:CCGGCCATCATTGATTTGGTTCATACTCGAGTATGAACCAAATCAATGATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198304
VALIDATED
NUP188 MISSION shRNA Lentiviral Transduction Particles
nucleoporin 188kDa
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000374827    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_198304.2-4957s21c1
Sequence:CCGGGCAGAAGGGACCCGAACATTACTCGAGTAATGTTCGGGTCCCTTCTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000178572    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_198304.2-1946s1c1
Sequence:CCGGCCAACATGACTCAGATGATTACTCGAGTAATCATCTGAGTCATGTTGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000198361    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198304.2-103s1c1
Sequence:CCGGGAGGCGGAACTGAATAAATATCTCGAGATATTTATTCAGTTCCGCCTCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000198628    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_198304.2-3240s1c1
Sequence:CCGGCGTCAAGTCTTTGGCAGTTTACTCGAGTAAACTGCCAAAGACTTGACGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000328273    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_198304.2-4229s21c1
Sequence:CCGGTCAAGACTCTACGCTACAATTCTCGAGAATTGTAGCGTAGAGTCTTGATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000328343    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_198304.2-5400s21c1
Sequence:CCGGTGCCCACCCGCTGACATTATTCTCGAGAATAATGTCAGCGGGTGGGCATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000328341    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_198304.2-1706s21c1
Sequence:CCGGCCATCATTGATTTGGTTCATACTCGAGTATGAACCAAATCAATGATGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000328342    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_198304.2-1946s21c1
Sequence:CCGGCCAACATGACTCAGATGATTACTCGAGTAATCATCTGAGTCATGTTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000197621    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_198304.2-1706s1c1
Sequence:CCGGCCATCATTGATTTGGTTCATACTCGAGTATGAACCAAATCAATGATGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015354
VALIDATED
NUP188 MISSION shRNA Bacterial Glycerol Stock
nucleoporin 188kDa
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000336996    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015354.1-910s21c1
Sequence:CCGGTGCGCAGGATGGGCTTATTTGCTCGAGCAAATAAGCCCATCCTGCGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336993    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015354.1-2485s21c1
Sequence:CCGGCAACAATGTTATTCGGCTGAACTCGAGTTCAGCCGAATAACATTGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146357    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015354.1-5513s1c1
Sequence:CCGGCTAGAGGAACTTTCCTTCCTTCTCGAGAAGGAAGGAAAGTTCCTCTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146975    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015354.1-2485s1c1
Sequence:CCGGCAACAATGTTATTCGGCTGAACTCGAGTTCAGCCGAATAACATTGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149292    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015354.1-3430s1c1
Sequence:CCGGGCTTGATGGAACCAAAGCATTCTCGAGAATGCTTTGGTTCCATCAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336997    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015354.1-1611s21c1
Sequence:CCGGTACGCTGGGAATACTCCTATACTCGAGTATAGGAGTATTCCCAGCGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337063    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015354.1-3430s21c1
Sequence:CCGGGCTTGATGGAACCAAAGCATTCTCGAGAATGCTTTGGTTCCATCAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350842    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015354.1-5513s21c1
Sequence:CCGGCTAGAGGAACTTTCCTTCCTTCTCGAGAAGGAAGGAAAGTTCCTCTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130400    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015354.1-862s1c1
Sequence:CCGGGTCCTTGCATAAGTGTGCTTTCTCGAGAAAGCACACTTATGCAAGGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015354
VALIDATED
NUP188 MISSION shRNA shRNA Plasmid DNA
nucleoporin 188kDa
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000336996    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015354.1-910s21c1
Sequence:CCGGTGCGCAGGATGGGCTTATTTGCTCGAGCAAATAAGCCCATCCTGCGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000336993    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015354.1-2485s21c1
Sequence:CCGGCAACAATGTTATTCGGCTGAACTCGAGTTCAGCCGAATAACATTGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000146357    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015354.1-5513s1c1
Sequence:CCGGCTAGAGGAACTTTCCTTCCTTCTCGAGAAGGAAGGAAAGTTCCTCTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000146975    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015354.1-2485s1c1
Sequence:CCGGCAACAATGTTATTCGGCTGAACTCGAGTTCAGCCGAATAACATTGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000149292    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015354.1-3430s1c1
Sequence:CCGGGCTTGATGGAACCAAAGCATTCTCGAGAATGCTTTGGTTCCATCAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000336997    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015354.1-1611s21c1
Sequence:CCGGTACGCTGGGAATACTCCTATACTCGAGTATAGGAGTATTCCCAGCGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000337063    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015354.1-3430s21c1
Sequence:CCGGGCTTGATGGAACCAAAGCATTCTCGAGAATGCTTTGGTTCCATCAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000350842    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015354.1-5513s21c1
Sequence:CCGGCTAGAGGAACTTTCCTTCCTTCTCGAGAAGGAAGGAAAGTTCCTCTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000130400    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015354.1-862s1c1
Sequence:CCGGGTCCTTGCATAAGTGTGCTTTCTCGAGAAAGCACACTTATGCAAGGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015354
VALIDATED
NUP188 MISSION shRNA Lentiviral Transduction Particles
nucleoporin 188kDa
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000336996    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015354.1-910s21c1
Sequence:CCGGTGCGCAGGATGGGCTTATTTGCTCGAGCAAATAAGCCCATCCTGCGCATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000336993    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015354.1-2485s21c1
Sequence:CCGGCAACAATGTTATTCGGCTGAACTCGAGTTCAGCCGAATAACATTGTTGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000146357    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015354.1-5513s1c1
Sequence:CCGGCTAGAGGAACTTTCCTTCCTTCTCGAGAAGGAAGGAAAGTTCCTCTAGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000146975    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015354.1-2485s1c1
Sequence:CCGGCAACAATGTTATTCGGCTGAACTCGAGTTCAGCCGAATAACATTGTTGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000149292    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015354.1-3430s1c1
Sequence:CCGGGCTTGATGGAACCAAAGCATTCTCGAGAATGCTTTGGTTCCATCAAGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000336997    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015354.1-1611s21c1
Sequence:CCGGTACGCTGGGAATACTCCTATACTCGAGTATAGGAGTATTCCCAGCGTATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000337063    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015354.1-3430s21c1
Sequence:CCGGGCTTGATGGAACCAAAGCATTCTCGAGAATGCTTTGGTTCCATCAAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000350842    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015354.1-5513s21c1
Sequence:CCGGCTAGAGGAACTTTCCTTCCTTCTCGAGAAGGAAGGAAAGTTCCTCTAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000130400    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015354.1-862s1c1
Sequence:CCGGGTCCTTGCATAAGTGTGCTTTCTCGAGAAAGCACACTTATGCAAGGACTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)