EMAIL THIS PAGE TO A FRIEND

NUP210

nucleoporin 210kDa

75 Gene Product Result for
Synonyms: GP210 POM210
Gene ID:
Human(23225) Summary: The nuclear pore complex is a massive structure that extends across the nuclear envelope, forming a gateway that regulates the flow of macromolecules between the nucleus and the cytoplasm. Nucleoporins are the main components of the nuclear pore complex in eukaryotic cells. The protein encoded by this gene is a membrane-spanning glycoprotein that is a major component of the nuclear pore complex. Multiple pseudogenes related to this gene are located on chromosome 3. [provided by RefSeq, Jul 2013]
Mouse(54563) nucleoporin 210
Rat(58958) nucleoporin 210
Zebrafish(570945) nucleoporin 210
cow(100125264) nucleoporin 210kDa
Horse(100055192) nucleoporin 210kDa
domestic cat(101083917) nucleoporin 210kDa
dog(484632) nucleoporin 210kDa
chicken(415977) nucleoporin 210kDa
domestic guinea pig(100715486) nucleoporin 210kDa
naked mole-rat(101696567) nucleoporin 210kDa
sheep(101110709) nucleoporin 210kDa
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018815 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_018815 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_018815 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_024923 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024923 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024923 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024923 Rosetta Predictions human pricing
NM_053322 Rosetta Predictions rat pricing
NM_018815 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024923 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00178575 predicted 2989
2 SASI_Hs01_00178576 predicted 4352
3 SASI_Hs01_00178578 predicted 868
4 SASI_Hs01_00178579 predicted 2946
5 SASI_Hs02_00357548 predicted 3050
6 SASI_Hs01_00178581 predicted 2069
7 SASI_Hs01_00178582 predicted 4920
8 SASI_Hs01_00178583 predicted 4311
9 SASI_Hs01_00178584 predicted 5504
10 SASI_Hs02_00357549 predicted 4364
11 SASI_Hs01_00178577 predicted 4939
12 SASI_Hs01_00178580 predicted 4177
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053322 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00090284 predicted 2381
2 SASI_Rn01_00090285 predicted 769
3 SASI_Rn01_00090286 predicted 2887
4 SASI_Rn01_00090287 predicted 3923
5 SASI_Rn01_00090288 predicted 1174
6 SASI_Rn01_00090289 predicted 3857
7 SASI_Rn01_00090290 predicted 2677
8 SASI_Rn01_00090291 predicted 1127
9 SASI_Rn01_00090292 predicted 833
10 SASI_Rn02_00265752 predicted 3059
11 SASI_Rn01_00090293 predicted 694
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018815 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00324156 predicted 1135
2 SASI_Mm01_00068445 predicted 1189
3 SASI_Mm01_00068446 predicted 2399
4 SASI_Mm01_00068447 predicted 2898
5 SASI_Mm01_00068449 predicted 1054
6 SASI_Mm01_00068450 predicted 2372
7 SASI_Mm01_00068453 predicted 528
8 SASI_Mm02_00324157 predicted 3863
9 SASI_Mm01_00068454 predicted 694
10 SASI_Mm02_00324158 predicted 1069
11 SASI_Mm01_00068448 predicted 5027
12 SASI_Mm01_00068451 predicted 1112
13 SASI_Mm01_00068452 predicted 1346
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018815
VALIDATED
NUP210 MISSION shRNA Bacterial Glycerol Stock
nucleoporin 210kDa
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000379190    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_018815.2-5500s21c1
Sequence:CCGGGGGACAGCAGTCACCATTATACTCGAGTATAATGGTGACTGCTGTCCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313571    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_018815.2-1452s21c1
Sequence:CCGGCGCCTATCAGTATACCATAAACTCGAGTTTATGGTATACTGATAGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313617    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_018815.2-1140s21c1
Sequence:CCGGTGCAATTACCATCGAAGTATTCTCGAGAATACTTCGATGGTAATTGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317115    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018815.2-6350s21c1
Sequence:CCGGGCCTTCTTACTGTGATAGTTACTCGAGTAACTATCACAGTAAGAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374938    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_018815.2-4131s21c1
Sequence:CCGGGACTATCCTTGTCGCTGTAAACTCGAGTTTACAGCGACAAGGATAGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101938    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018815.1-4957s1c1
Sequence:CCGGGCTGACAGATAAGCAACTGAACTCGAGTTCAGTTGCTTATCTGTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101936    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018815.1-2033s1c1
Sequence:CCGGCCTTCCAAATTCTTTCGGAATCTCGAGATTCCGAAAGAATTTGGAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101937    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018815.1-3223s1c1
Sequence:CCGGCCCACAACAAATCGAGGTCTTCTCGAGAAGACCTCGATTTGTTGTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101939    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018815.1-1153s1c1
Sequence:CCGGCCCATCTGACAACATCCGAATCTCGAGATTCGGATGTTGTCAGATGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101935    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018815.1-6316s1c1
Sequence:CCGGGCCTTCTTACTGTGATAGTTACTCGAGTAACTATCACAGTAAGAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313616    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_018815.2-865s21c1
Sequence:CCGGTCAATGCCTTCTGATCAATATCTCGAGATATTGATCAGAAGGCATTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018815
VALIDATED
NUP210 MISSION shRNA shRNA Plasmid DNA
nucleoporin 210kDa
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000379190    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_018815.2-5500s21c1
Sequence:CCGGGGGACAGCAGTCACCATTATACTCGAGTATAATGGTGACTGCTGTCCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000313571    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_018815.2-1452s21c1
Sequence:CCGGCGCCTATCAGTATACCATAAACTCGAGTTTATGGTATACTGATAGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000313617    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_018815.2-1140s21c1
Sequence:CCGGTGCAATTACCATCGAAGTATTCTCGAGAATACTTCGATGGTAATTGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000317115    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018815.2-6350s21c1
Sequence:CCGGGCCTTCTTACTGTGATAGTTACTCGAGTAACTATCACAGTAAGAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000374938    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_018815.2-4131s21c1
Sequence:CCGGGACTATCCTTGTCGCTGTAAACTCGAGTTTACAGCGACAAGGATAGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101938    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018815.1-4957s1c1
Sequence:CCGGGCTGACAGATAAGCAACTGAACTCGAGTTCAGTTGCTTATCTGTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101936    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018815.1-2033s1c1
Sequence:CCGGCCTTCCAAATTCTTTCGGAATCTCGAGATTCCGAAAGAATTTGGAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101937    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018815.1-3223s1c1
Sequence:CCGGCCCACAACAAATCGAGGTCTTCTCGAGAAGACCTCGATTTGTTGTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101939    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018815.1-1153s1c1
Sequence:CCGGCCCATCTGACAACATCCGAATCTCGAGATTCGGATGTTGTCAGATGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101935    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018815.1-6316s1c1
Sequence:CCGGGCCTTCTTACTGTGATAGTTACTCGAGTAACTATCACAGTAAGAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000313616    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_018815.2-865s21c1
Sequence:CCGGTCAATGCCTTCTGATCAATATCTCGAGATATTGATCAGAAGGCATTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018815
VALIDATED
NUP210 MISSION shRNA Lentiviral Transduction Particles
nucleoporin 210kDa
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000379190    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_018815.2-5500s21c1
Sequence:CCGGGGGACAGCAGTCACCATTATACTCGAGTATAATGGTGACTGCTGTCCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313571    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_018815.2-1452s21c1
Sequence:CCGGCGCCTATCAGTATACCATAAACTCGAGTTTATGGTATACTGATAGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313617    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_018815.2-1140s21c1
Sequence:CCGGTGCAATTACCATCGAAGTATTCTCGAGAATACTTCGATGGTAATTGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317115    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018815.2-6350s21c1
Sequence:CCGGGCCTTCTTACTGTGATAGTTACTCGAGTAACTATCACAGTAAGAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374938    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_018815.2-4131s21c1
Sequence:CCGGGACTATCCTTGTCGCTGTAAACTCGAGTTTACAGCGACAAGGATAGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101938    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018815.1-4957s1c1
Sequence:CCGGGCTGACAGATAAGCAACTGAACTCGAGTTCAGTTGCTTATCTGTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101936    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018815.1-2033s1c1
Sequence:CCGGCCTTCCAAATTCTTTCGGAATCTCGAGATTCCGAAAGAATTTGGAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101937    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018815.1-3223s1c1
Sequence:CCGGCCCACAACAAATCGAGGTCTTCTCGAGAAGACCTCGATTTGTTGTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101939    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018815.1-1153s1c1
Sequence:CCGGCCCATCTGACAACATCCGAATCTCGAGATTCGGATGTTGTCAGATGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101935    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018815.1-6316s1c1
Sequence:CCGGGCCTTCTTACTGTGATAGTTACTCGAGTAACTATCACAGTAAGAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313616    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_018815.2-865s21c1
Sequence:CCGGTCAATGCCTTCTGATCAATATCTCGAGATATTGATCAGAAGGCATTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024923
NUP210 MISSION shRNA Bacterial Glycerol Stock
nucleoporin 210kDa
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000152698    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024923.2-1492s1c1
Sequence:CCGGGCGCCTATCAGTACACAATAACTCGAGTTATTGTGTACTGATAGGCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152851    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024923.2-753s1c1
Sequence:CCGGGAGGCTGTCTACAAGAATGTACTCGAGTACATTCTTGTAGACAGCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153158    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024923.2-6091s1c1
Sequence:CCGGGAGCAGTTAGAAGTGCTCTTTCTCGAGAAAGAGCACTTCTAACTGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157497    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024923.2-2997s1c1
Sequence:CCGGGTCGTTTACGTGTCGGACATTCTCGAGAATGTCCGACACGTAAACGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157612    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024923.2-4935s1c1
Sequence:CCGGGCCGTCTTTGATTTCCCATCTCTCGAGAGATGGGAAATCAAAGACGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156619    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024923.2-5908s1c1
Sequence:CCGGGCTCTGCCCATTAGCTCATTTCTCGAGAAATGAGCTAATGGGCAGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153724    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024923.2-3296s1c1
Sequence:CCGGCCCACAACAGATTGAAGTCTTCTCGAGAAGACTTCAATCTGTTGTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151745    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024923.2-1231s1c1
Sequence:CCGGCTGACAACATCCGAATTGAAACTCGAGTTTCAATTCGGATGTTGTCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024923
NUP210 MISSION shRNA shRNA Plasmid DNA
nucleoporin 210kDa
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000152698    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024923.2-1492s1c1
Sequence:CCGGGCGCCTATCAGTACACAATAACTCGAGTTATTGTGTACTGATAGGCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152851    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024923.2-753s1c1
Sequence:CCGGGAGGCTGTCTACAAGAATGTACTCGAGTACATTCTTGTAGACAGCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153158    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024923.2-6091s1c1
Sequence:CCGGGAGCAGTTAGAAGTGCTCTTTCTCGAGAAAGAGCACTTCTAACTGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000157497    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024923.2-2997s1c1
Sequence:CCGGGTCGTTTACGTGTCGGACATTCTCGAGAATGTCCGACACGTAAACGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000157612    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024923.2-4935s1c1
Sequence:CCGGGCCGTCTTTGATTTCCCATCTCTCGAGAGATGGGAAATCAAAGACGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000156619    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024923.2-5908s1c1
Sequence:CCGGGCTCTGCCCATTAGCTCATTTCTCGAGAAATGAGCTAATGGGCAGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153724    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024923.2-3296s1c1
Sequence:CCGGCCCACAACAGATTGAAGTCTTCTCGAGAAGACTTCAATCTGTTGTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151745    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024923.2-1231s1c1
Sequence:CCGGCTGACAACATCCGAATTGAAACTCGAGTTTCAATTCGGATGTTGTCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024923
NUP210 MISSION shRNA Lentiviral Transduction Particles
nucleoporin 210kDa
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000152698    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024923.2-1492s1c1
Sequence:CCGGGCGCCTATCAGTACACAATAACTCGAGTTATTGTGTACTGATAGGCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152851    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024923.2-753s1c1
Sequence:CCGGGAGGCTGTCTACAAGAATGTACTCGAGTACATTCTTGTAGACAGCCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153158    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024923.2-6091s1c1
Sequence:CCGGGAGCAGTTAGAAGTGCTCTTTCTCGAGAAAGAGCACTTCTAACTGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157497    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024923.2-2997s1c1
Sequence:CCGGGTCGTTTACGTGTCGGACATTCTCGAGAATGTCCGACACGTAAACGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157612    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024923.2-4935s1c1
Sequence:CCGGGCCGTCTTTGATTTCCCATCTCTCGAGAGATGGGAAATCAAAGACGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156619    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024923.2-5908s1c1
Sequence:CCGGGCTCTGCCCATTAGCTCATTTCTCGAGAAATGAGCTAATGGGCAGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153724    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024923.2-3296s1c1
Sequence:CCGGCCCACAACAGATTGAAGTCTTCTCGAGAAGACTTCAATCTGTTGTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151745    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024923.2-1231s1c1
Sequence:CCGGCTGACAACATCCGAATTGAAACTCGAGTTTCAATTCGGATGTTGTCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)