EMAIL THIS PAGE TO A FRIEND

NUP210L

nucleoporin 210kDa-like

100 Gene Product Result for
Synonyms: RP11-144B19.1
UniProtKB ID: Q5VU65, Q5T4L7, Q6ZRN1, Q6ZRT4, Q6ZU81, Q8NDI6
Gene ID:
Mouse(77595) nucleoporin 210-like
Rat(365844) nucleoporin 210-like
sheep(101102613) nucleoporin 210kDa-like
naked mole-rat(101706032) nucleoporin 210kDa-like
Domestic Rabbit(100348493) nucleoporin 210kDa-like
domestic guinea pig(100729941) nucleoporin 210kDa-like
chicken(426146) nucleoporin 210kDa-like
cow(785834) nucleoporin 210kDa-like
Horse(100056659) nucleoporin 210kDa-like
domestic cat(101086449) nucleoporin 210kDa-like
dog(490448) nucleoporin 210kDa-like
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_207308 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_207308 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_207308 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_029937 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029937 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029937 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU209821 MISSION® esiRNA esiRNA targeting mouse Nup210l mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_207308 Rosetta Predictions human pricing
XM_001074975 Rosetta Predictions rat pricing
XM_345234 Rosetta Predictions rat pricing
XM_001479463 Rosetta Predictions mouse pricing
XM_622896 Rosetta Predictions mouse pricing
XM_910403 Rosetta Predictions mouse pricing
XM_982763 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207308 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00232359 predicted 1171
2 SASI_Hs01_00232360 predicted 2791
3 SASI_Hs01_00232361 predicted 4739
4 SASI_Hs01_00232362 predicted 1577
5 SASI_Hs02_00373831 predicted 4950
6 SASI_Hs01_00232365 predicted 3626
7 SASI_Hs01_00232366 predicted 5165
8 SASI_Hs02_00373832 predicted 3687
9 SASI_Hs02_00373833 predicted 2535
10 SASI_Hs02_00373834 predicted 799
11 SASI_Hs01_00232357 predicted 3637
12 SASI_Hs01_00232358 predicted 1618
13 SASI_Hs01_00232363 predicted 3106
14 SASI_Hs01_00232364 predicted 3649
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001074975 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00347952 predicted 297
2 SASI_Rn02_00347953 predicted 1333
3 SASI_Rn02_00347954 predicted 4035
4 SASI_Rn02_00347955 predicted 2798
5 SASI_Rn02_00347956 predicted 281
6 SASI_Rn02_00347957 predicted 3076
7 SASI_Rn02_00347958 predicted 3565
8 SASI_Rn02_00347959 predicted 2268
9 SASI_Rn02_00347960 predicted 214
10 SASI_Rn02_00347961 predicted 1422
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_345234 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00169496 predicted 301
2 SASI_Rn02_00398071 predicted 1336
3 SASI_Rn02_00398072 predicted 4040
4 SASI_Rn02_00398073 predicted 2806
5 SASI_Rn02_00398074 predicted 290
6 SASI_Rn02_00398075 predicted 3076
7 SASI_Rn02_00398076 predicted 3572
8 SASI_Rn02_00398077 predicted 2269
9 SASI_Rn01_00169504 predicted 212
10 SASI_Rn02_00398078 predicted 1419
11 SASI_Rn01_00169497 predicted 251
12 SASI_Rn01_00169498 predicted 281
13 SASI_Rn01_00169499 predicted 377
14 SASI_Rn01_00169500 predicted 414
15 SASI_Rn01_00169501 predicted 202
16 SASI_Rn01_00169502 predicted 291
17 SASI_Rn01_00169503 predicted 350
18 SASI_Rn01_00169505 predicted 369
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001479463 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00410136 predicted 2410
2 SASI_Mm02_00410137 predicted 3297
3 SASI_Mm02_00410138 predicted 4011
4 SASI_Mm02_00410139 predicted 2301
5 SASI_Mm02_00410140 predicted 4900
6 SASI_Mm02_00410141 predicted 5231
7 SASI_Mm02_00410142 predicted 5299
8 SASI_Mm02_00410143 predicted 5117
9 SASI_Mm02_00410144 predicted 5255
10 SASI_Mm02_00410145 predicted 1704
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_622896 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00428002 predicted 1246
2 SASI_Mm02_00428003 predicted 1208
3 SASI_Mm02_00428004 predicted 2130
4 SASI_Mm02_00428005 predicted 2845
5 SASI_Mm02_00428006 predicted 1133
6 SASI_Mm02_00428007 predicted 3737
7 SASI_Mm02_00428008 predicted 4060
8 SASI_Mm02_00428009 predicted 4134
9 SASI_Mm02_00428010 predicted 3954
10 SASI_Mm02_00428011 predicted 4089
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_910403 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00216927 predicted 2318
2 SASI_Mm01_00216928 predicted 3917
3 SASI_Mm01_00216929 predicted 303
4 SASI_Mm01_00216930 predicted 2209
5 SASI_Mm01_00216931 predicted 4811
6 SASI_Mm01_00216932 predicted 5139
7 SASI_Mm01_00216933 predicted 5027
8 SASI_Mm01_00216934 predicted 5162
9 SASI_Mm01_00216935 predicted 3517
10 SASI_Mm01_00216936 predicted 770
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_982763 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00447905 predicted 2409
2 SASI_Mm02_00447906 predicted 4005
3 SASI_Mm02_00447907 predicted 334
4 SASI_Mm02_00447908 predicted 242
5 SASI_Mm02_00447909 predicted 4901
6 SASI_Mm02_00447910 predicted 5232
7 SASI_Mm02_00447911 predicted 5303
8 SASI_Mm02_00447912 predicted 5124
9 SASI_Mm02_00447913 predicted 5255
10 SASI_Mm02_00447914 predicted 1701
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_207308
NUP210L MISSION shRNA Bacterial Glycerol Stock
nucleoporin 210kDa-like
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000145362    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207308.1-4692s1c1
Sequence:CCGGGAGGGCTATGAAAGATAAGTTCTCGAGAACTTATCTTTCATAGCCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145042    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207308.1-4438s1c1
Sequence:CCGGGAATTGGTTCTTAGCCACAAACTCGAGTTTGTGGCTAAGAACCAATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144972    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207308.1-4223s1c1
Sequence:CCGGGTAAAGTCTTTCAGGTCCATTCTCGAGAATGGACCTGAAAGACTTTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145191    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207308.1-1176s1c1
Sequence:CCGGGCATTGTTCCAGTACACATATCTCGAGATATGTGTACTGGAACAATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142474    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207308.1-2890s1c1
Sequence:CCGGGCTACCAAGATGCCAGTTTATCTCGAGATAAACTGGCATCTTGGTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140425    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207308.1-4963s1c1
Sequence:CCGGGTCGGCTGCAACATTGGTTATCTCGAGATAACCAATGTTGCAGCCGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140685    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207308.1-1878s1c1
Sequence:CCGGCCGGTTACATGGTCATCAGATCTCGAGATCTGATGACCATGTAACCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139634    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207308.1-2560s1c1
Sequence:CCGGCCTCGGCACATTGAAGTGTTTCTCGAGAAACACTTCAATGTGCCGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_207308
NUP210L MISSION shRNA shRNA Plasmid DNA
nucleoporin 210kDa-like
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000145362    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207308.1-4692s1c1
Sequence:CCGGGAGGGCTATGAAAGATAAGTTCTCGAGAACTTATCTTTCATAGCCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000145042    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207308.1-4438s1c1
Sequence:CCGGGAATTGGTTCTTAGCCACAAACTCGAGTTTGTGGCTAAGAACCAATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144972    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207308.1-4223s1c1
Sequence:CCGGGTAAAGTCTTTCAGGTCCATTCTCGAGAATGGACCTGAAAGACTTTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000145191    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207308.1-1176s1c1
Sequence:CCGGGCATTGTTCCAGTACACATATCTCGAGATATGTGTACTGGAACAATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142474    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207308.1-2890s1c1
Sequence:CCGGGCTACCAAGATGCCAGTTTATCTCGAGATAAACTGGCATCTTGGTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140425    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207308.1-4963s1c1
Sequence:CCGGGTCGGCTGCAACATTGGTTATCTCGAGATAACCAATGTTGCAGCCGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140685    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207308.1-1878s1c1
Sequence:CCGGCCGGTTACATGGTCATCAGATCTCGAGATCTGATGACCATGTAACCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139634    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207308.1-2560s1c1
Sequence:CCGGCCTCGGCACATTGAAGTGTTTCTCGAGAAACACTTCAATGTGCCGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_207308
NUP210L MISSION shRNA Lentiviral Transduction Particles
nucleoporin 210kDa-like
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000145362    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207308.1-4692s1c1
Sequence:CCGGGAGGGCTATGAAAGATAAGTTCTCGAGAACTTATCTTTCATAGCCCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145042    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207308.1-4438s1c1
Sequence:CCGGGAATTGGTTCTTAGCCACAAACTCGAGTTTGTGGCTAAGAACCAATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144972    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207308.1-4223s1c1
Sequence:CCGGGTAAAGTCTTTCAGGTCCATTCTCGAGAATGGACCTGAAAGACTTTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145191    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207308.1-1176s1c1
Sequence:CCGGGCATTGTTCCAGTACACATATCTCGAGATATGTGTACTGGAACAATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142474    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207308.1-2890s1c1
Sequence:CCGGGCTACCAAGATGCCAGTTTATCTCGAGATAAACTGGCATCTTGGTAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140425    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207308.1-4963s1c1
Sequence:CCGGGTCGGCTGCAACATTGGTTATCTCGAGATAACCAATGTTGCAGCCGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140685    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207308.1-1878s1c1
Sequence:CCGGCCGGTTACATGGTCATCAGATCTCGAGATCTGATGACCATGTAACCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139634    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207308.1-2560s1c1
Sequence:CCGGCCTCGGCACATTGAAGTGTTTCTCGAGAAACACTTCAATGTGCCGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029937
NUP210L MISSION shRNA Bacterial Glycerol Stock
nucleoporin 210kDa-like
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000346607    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029937.1-2492s21c1
Sequence:CCGGCAACGAGACACTAGCTCATTTCTCGAGAAATGAGCTAGTGTCTCGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000346610    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029937.1-5220s21c1
Sequence:CCGGCTAGCAGTGTCTGGCTATAAGCTCGAGCTTATAGCCAGACACTGCTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000346530    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029937.1-3865s21c1
Sequence:CCGGAGATCCAGATCCTGGTATTTGCTCGAGCAAATACCAGGATCTGGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000346609    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029937.1-1793s21c1
Sequence:CCGGCCTCGATCTCAACTCGGATAACTCGAGTTATCCGAGTTGAGATCGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000346608    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029937.1-813s21c1
Sequence:CCGGCTCTTAGTAGGAGCCTATATTCTCGAGAATATAGGCTCCTACTAAGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029937
NUP210L MISSION shRNA shRNA Plasmid DNA
nucleoporin 210kDa-like
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000346607    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029937.1-2492s21c1
Sequence:CCGGCAACGAGACACTAGCTCATTTCTCGAGAAATGAGCTAGTGTCTCGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000346610    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029937.1-5220s21c1
Sequence:CCGGCTAGCAGTGTCTGGCTATAAGCTCGAGCTTATAGCCAGACACTGCTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000346530    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029937.1-3865s21c1
Sequence:CCGGAGATCCAGATCCTGGTATTTGCTCGAGCAAATACCAGGATCTGGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000346609    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029937.1-1793s21c1
Sequence:CCGGCCTCGATCTCAACTCGGATAACTCGAGTTATCCGAGTTGAGATCGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000346608    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029937.1-813s21c1
Sequence:CCGGCTCTTAGTAGGAGCCTATATTCTCGAGAATATAGGCTCCTACTAAGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029937
NUP210L MISSION shRNA Lentiviral Transduction Particles
nucleoporin 210kDa-like
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000346607    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029937.1-2492s21c1
Sequence:CCGGCAACGAGACACTAGCTCATTTCTCGAGAAATGAGCTAGTGTCTCGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000346610    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029937.1-5220s21c1
Sequence:CCGGCTAGCAGTGTCTGGCTATAAGCTCGAGCTTATAGCCAGACACTGCTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000346530    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029937.1-3865s21c1
Sequence:CCGGAGATCCAGATCCTGGTATTTGCTCGAGCAAATACCAGGATCTGGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000346609    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029937.1-1793s21c1
Sequence:CCGGCCTCGATCTCAACTCGGATAACTCGAGTTATCCGAGTTGAGATCGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000346608    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029937.1-813s21c1
Sequence:CCGGCTCTTAGTAGGAGCCTATATTCTCGAGAATATAGGCTCCTACTAAGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)