EMAIL THIS PAGE TO A FRIEND

NUP214

nucleoporin 214kDa

60 Gene Product Result for
Synonyms: CAIN CAN D9S46E N214 p250
Gene ID:
Human(8021) Summary: The nuclear pore complex is a massive structure that extends across the nuclear envelope, forming a gateway that regulates the flow of macromolecules between the nucleus and the cytoplasm. Nucleoporins are the main components of the nuclear pore complex in eukaryotic cells. This gene is a member of the FG-repeat-containing nucleoporins. The protein encoded by this gene is localized to the cytoplasmic face of the nuclear pore complex where it is required for proper cell cycle progression and nucleocytoplasmic transport. The 3' portion of this gene forms a fusion gene with the DEK gene on chromosome 6 in a t(6,9) translocation associated with acute myeloid leukemia and myelodysplastic syndrome. [provided by RefSeq, Jul 2008]
Mouse(227720) nucleoporin 214
Rat(296634) nucleoporin 214
fruit fly(46091) Nucleoporin 214
chicken(427760) nucleoporin 214kDa
Zebrafish(100529857) nucleoporin 214
dog(608534) nucleoporin 214kDa
Horse(100069634) nucleoporin 214kDa
cow(784219) nucleoporin 214kDa
domestic cat(101099000) nucleoporin 214kDa
domestic guinea pig(100729364) nucleoporin 214kDa
Domestic Rabbit(100355984) nucleoporin 214kDa
naked mole-rat(101722062) nucleoporin 214kDa
sheep(101114502) nucleoporin 214kDa
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005085 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005085 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005085 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_172268 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172268 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172268 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU083381 MISSION® esiRNA esiRNA human NUP214 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005085 Rosetta Predictions human pricing
XM_001077983 Rosetta Predictions rat pricing
XM_238325 Rosetta Predictions rat pricing
NM_172268 Rosetta Predictions mouse pricing
XM_358340 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005085 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00081174 predicted 1108
2 SASI_Hs01_00081175 predicted 4174
3 SASI_Hs01_00081177 predicted 3302
4 SASI_Hs01_00081178 predicted 3329
5 SASI_Hs01_00081179 predicted 4581
6 SASI_Hs01_00081180 predicted 1798
7 SASI_Hs01_00081181 predicted 2465
8 SASI_Hs02_00338933 predicted 3428
9 SASI_Hs01_00081182 predicted 3050
10 SASI_Hs01_00081183 predicted 518
11 SASI_Hs01_00081176 predicted 3611
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001077983 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00359212 predicted 3302
2 SASI_Rn02_00359213 predicted 5797
3 SASI_Rn02_00359214 predicted 1122
4 SASI_Rn02_00359215 predicted 2602
5 SASI_Rn02_00359216 predicted 455
6 SASI_Rn02_00359217 predicted 360
7 SASI_Rn02_00359218 predicted 3320
8 SASI_Rn02_00359219 predicted 429
9 SASI_Rn02_00359220 predicted 6265
10 SASI_Rn02_00359221 predicted 863
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_238325 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00391316 predicted 3299
2 SASI_Rn02_00391317 predicted 5796
3 SASI_Rn02_00391318 predicted 1115
4 SASI_Rn02_00391319 predicted 2599
5 SASI_Rn02_00391320 predicted 453
6 SASI_Rn02_00391321 predicted 358
7 SASI_Rn02_00391322 predicted 3322
8 SASI_Rn02_00391323 predicted 429
9 SASI_Rn02_00391324 predicted 6265
10 SASI_Rn02_00391325 predicted 867
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172268 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00343738 predicted 230
2 SASI_Mm02_00343739 predicted 2002
3 SASI_Mm02_00343740 predicted 626
4 SASI_Mm02_00343741 predicted 1115
5 SASI_Mm02_00343742 predicted 526
6 SASI_Mm02_00343743 predicted 5836
7 SASI_Mm02_00343744 predicted 1181
8 SASI_Mm02_00343745 predicted 2594
9 SASI_Mm02_00343746 predicted 351
10 SASI_Mm02_00343747 predicted 862
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_358340 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00254827 predicted 2018
2 SASI_Mm01_00254828 predicted 2335
3 SASI_Mm01_00254829 predicted 2603
4 SASI_Mm01_00254830 predicted 2106
5 SASI_Mm01_00254831 predicted 4259
6 SASI_Mm01_00254832 predicted 4194
7 SASI_Mm01_00254833 predicted 4090
8 SASI_Mm01_00254834 predicted 2808
9 SASI_Mm01_00254835 predicted 2867
10 SASI_Mm01_00254836 predicted 2572
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005085
VALIDATED
NUP214 MISSION shRNA Bacterial Glycerol Stock
nucleoporin 214kDa
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000273572    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_005085.2-3644s21c1
Sequence:CCGGCACCAGCATCCGGTCAGTTATCTCGAGATAACTGACCGGATGCTGGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273515    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_005085.2-6400s21c1
Sequence:CCGGCCTTTCGATCCCTGGGACCAACTCGAGTTGGTCCCAGGGATCGAAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273516    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 2 Clone ID:NM_005085.2-519s21c1
Sequence:CCGGACGCCCATTTGCCTATCATAACTCGAGTTATGATAGGCAAATGGGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273518    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_005085.2-2557s21c1
Sequence:CCGGCGCCTTCATCAGTATGTGAAACTCGAGTTTCACATACTGATGAAGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005555    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_005085.2-2557s1c1
Sequence:CCGGCGCCTTCATCAGTATGTGAAACTCGAGTTTCACATACTGATGAAGGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005556    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_005085.2-4130s1c1
Sequence:CCGGGCCAAGCAGATGATTCTACAACTCGAGTTGTAGAATCATCTGCTTGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005558    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_005085.2-2882s1c1
Sequence:CCGGCCATAGAATCTCACACCAAATCTCGAGATTTGGTGTGAGATTCTATGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005554    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_005085.2-6400s1c1
Sequence:CCGGCCTTTCGATCCCTGGGACCAACTCGAGTTGGTCCCAGGGATCGAAAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273517    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 2 Clone ID:NM_005085.2-2882s21c1
Sequence:CCGGCCATAGAATCTCACACCAAATCTCGAGATTTGGTGTGAGATTCTATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005557    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005085.2-379s1c1
Sequence:CCGGCCTATGAAATTCCCAATCCATCTCGAGATGGATTGGGAATTTCATAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005085
VALIDATED
NUP214 MISSION shRNA shRNA Plasmid DNA
nucleoporin 214kDa
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000273572    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_005085.2-3644s21c1
Sequence:CCGGCACCAGCATCCGGTCAGTTATCTCGAGATAACTGACCGGATGCTGGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000273515    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_005085.2-6400s21c1
Sequence:CCGGCCTTTCGATCCCTGGGACCAACTCGAGTTGGTCCCAGGGATCGAAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000273516    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 2 Clone ID:NM_005085.2-519s21c1
Sequence:CCGGACGCCCATTTGCCTATCATAACTCGAGTTATGATAGGCAAATGGGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000273518    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_005085.2-2557s21c1
Sequence:CCGGCGCCTTCATCAGTATGTGAAACTCGAGTTTCACATACTGATGAAGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005555    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_005085.2-2557s1c1
Sequence:CCGGCGCCTTCATCAGTATGTGAAACTCGAGTTTCACATACTGATGAAGGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005556    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_005085.2-4130s1c1
Sequence:CCGGGCCAAGCAGATGATTCTACAACTCGAGTTGTAGAATCATCTGCTTGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005558    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_005085.2-2882s1c1
Sequence:CCGGCCATAGAATCTCACACCAAATCTCGAGATTTGGTGTGAGATTCTATGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005554    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_005085.2-6400s1c1
Sequence:CCGGCCTTTCGATCCCTGGGACCAACTCGAGTTGGTCCCAGGGATCGAAAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000273517    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 2 Clone ID:NM_005085.2-2882s21c1
Sequence:CCGGCCATAGAATCTCACACCAAATCTCGAGATTTGGTGTGAGATTCTATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005557    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005085.2-379s1c1
Sequence:CCGGCCTATGAAATTCCCAATCCATCTCGAGATGGATTGGGAATTTCATAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005085
VALIDATED
NUP214 MISSION shRNA Lentiviral Transduction Particles
nucleoporin 214kDa
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000273572    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_005085.2-3644s21c1
Sequence:CCGGCACCAGCATCCGGTCAGTTATCTCGAGATAACTGACCGGATGCTGGTGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000273515    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_005085.2-6400s21c1
Sequence:CCGGCCTTTCGATCCCTGGGACCAACTCGAGTTGGTCCCAGGGATCGAAAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000273516    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 2 Clone ID:NM_005085.2-519s21c1
Sequence:CCGGACGCCCATTTGCCTATCATAACTCGAGTTATGATAGGCAAATGGGCGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000273518    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_005085.2-2557s21c1
Sequence:CCGGCGCCTTCATCAGTATGTGAAACTCGAGTTTCACATACTGATGAAGGCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005555    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_005085.2-2557s1c1
Sequence:CCGGCGCCTTCATCAGTATGTGAAACTCGAGTTTCACATACTGATGAAGGCGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005556    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_005085.2-4130s1c1
Sequence:CCGGGCCAAGCAGATGATTCTACAACTCGAGTTGTAGAATCATCTGCTTGGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005558    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_005085.2-2882s1c1
Sequence:CCGGCCATAGAATCTCACACCAAATCTCGAGATTTGGTGTGAGATTCTATGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005554    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_005085.2-6400s1c1
Sequence:CCGGCCTTTCGATCCCTGGGACCAACTCGAGTTGGTCCCAGGGATCGAAAGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000273517    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 2 Clone ID:NM_005085.2-2882s21c1
Sequence:CCGGCCATAGAATCTCACACCAAATCTCGAGATTTGGTGTGAGATTCTATGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005557    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005085.2-379s1c1
Sequence:CCGGCCTATGAAATTCCCAATCCATCTCGAGATGGATTGGGAATTTCATAGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172268
VALIDATED
NUP214 MISSION shRNA Bacterial Glycerol Stock
nucleoporin 214kDa
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000267620    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172268.2-8013s21c1
Sequence:CCGGGATCCACCCTTTCCGATATATCTCGAGATATATCGGAAAGGGTGGATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253122    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172268.2-2879s21c1
Sequence:CCGGCTCCCAGAGTGCCAGGTAAATCTCGAGATTTACCTGGCACTCTGGGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253124    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172268.2-1203s21c1
Sequence:CCGGGGGTGTTGCCATAGATTATACCTCGAGGTATAATCTATGGCAACACCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000267581    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172268.2-4447s21c1
Sequence:CCGGGCTAGTAGCAAAGCTAGTTTCCTCGAGGAAACTAGCTTTGCTACTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253123    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172268.2-850s21c1
Sequence:CCGGGTGCTATGGATTGGTACATATCTCGAGATATGTACCAATCCATAGCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172268
VALIDATED
NUP214 MISSION shRNA shRNA Plasmid DNA
nucleoporin 214kDa
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000267620    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172268.2-8013s21c1
Sequence:CCGGGATCCACCCTTTCCGATATATCTCGAGATATATCGGAAAGGGTGGATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000253122    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172268.2-2879s21c1
Sequence:CCGGCTCCCAGAGTGCCAGGTAAATCTCGAGATTTACCTGGCACTCTGGGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000253124    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172268.2-1203s21c1
Sequence:CCGGGGGTGTTGCCATAGATTATACCTCGAGGTATAATCTATGGCAACACCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000267581    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172268.2-4447s21c1
Sequence:CCGGGCTAGTAGCAAAGCTAGTTTCCTCGAGGAAACTAGCTTTGCTACTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000253123    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172268.2-850s21c1
Sequence:CCGGGTGCTATGGATTGGTACATATCTCGAGATATGTACCAATCCATAGCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172268
VALIDATED
NUP214 MISSION shRNA Lentiviral Transduction Particles
nucleoporin 214kDa
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000267620    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172268.2-8013s21c1
Sequence:CCGGGATCCACCCTTTCCGATATATCTCGAGATATATCGGAAAGGGTGGATCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000253122    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172268.2-2879s21c1
Sequence:CCGGCTCCCAGAGTGCCAGGTAAATCTCGAGATTTACCTGGCACTCTGGGAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000253124    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172268.2-1203s21c1
Sequence:CCGGGGGTGTTGCCATAGATTATACCTCGAGGTATAATCTATGGCAACACCCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000267581    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172268.2-4447s21c1
Sequence:CCGGGCTAGTAGCAAAGCTAGTTTCCTCGAGGAAACTAGCTTTGCTACTAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000253123    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172268.2-850s21c1
Sequence:CCGGGTGCTATGGATTGGTACATATCTCGAGATATGTACCAATCCATAGCACTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)