EMAIL THIS PAGE TO A FRIEND

NUP37

nucleoporin 37kDa

72 Gene Product Result for
Synonyms: p37
UniProtKB ID: Q8NFH4, Q9H644
Gene ID:
Human(79023) Summary: Bidirectional transport of macromolecules between the cytoplasm and nucleus occurs through nuclear pore complexes (NPCs) embedded in the nuclear envelope. NPCs are composed of subcomplexes, and NUP37 is part of one such subcomplex, Nup107-160 (Loiodice et al., 2004 [PubMed 15146057]
Mouse(69736) nucleoporin 37
Rat(299706) nucleoporin 37
Zebrafish(436892) nucleoporin 37
domestic cat(101100740) nucleoporin 37kDa
cow(100139879) nucleoporin 37kDa
Horse(100053164) nucleoporin 37kDa
dog(475445) nucleoporin 37kDa
chicken(418093) nucleoporin 37kDa
domestic guinea pig(100715068) nucleoporin 37kDa
naked mole-rat(101708985) nucleoporin 37kDa
sheep(101109606) nucleoporin 37kDa
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_027191 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027191 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027191 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_024057 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024057 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024057 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU048011 MISSION® esiRNA esiRNA targeting human NUP37 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024057 Rosetta Predictions human pricing
NM_001106775 Rosetta Predictions rat pricing
NM_027191 Rosetta Predictions mouse pricing
NM_028334 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024057 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00039585 predicted 770
2 SASI_Hs01_00039586 predicted 430
3 SASI_Hs02_00356511 predicted 234
4 SASI_Hs01_00039587 predicted 683
5 SASI_Hs01_00039588 predicted 813
6 SASI_Hs01_00039589 predicted 385
7 SASI_Hs01_00039590 predicted 673
8 SASI_Hs02_00356512 predicted 719
9 SASI_Hs01_00039592 predicted 516
10 SASI_Hs02_00356513 predicted 682
11 SASI_Hs01_00039591 predicted 747
12 SASI_Hs01_00039593 predicted 759
13 SASI_Hs01_00039594 predicted 438
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106775 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00222278 predicted 1114
2 SASI_Rn02_00222279 predicted 260
3 SASI_Rn02_00222280 predicted 940
4 SASI_Rn02_00222281 predicted 861
5 SASI_Rn02_00222282 predicted 340
6 SASI_Rn02_00222283 predicted 966
7 SASI_Rn02_00222284 predicted 295
8 SASI_Rn02_00222285 predicted 668
9 SASI_Rn02_00222286 predicted 1004
10 SASI_Rn02_00222287 predicted 788
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027191 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00059625 predicted 768
2 SASI_Mm02_00331724 predicted 608
3 SASI_Mm01_00059626 predicted 791
4 SASI_Mm02_00331725 predicted 451
5 SASI_Mm02_00331726 predicted 467
6 SASI_Mm02_00331727 predicted 578
7 SASI_Mm02_00331728 predicted 386
8 SASI_Mm01_00059630 predicted 696
9 SASI_Mm02_00331729 predicted 790
10 SASI_Mm02_00331730 predicted 447
11 SASI_Mm01_00059623 predicted 779
12 SASI_Mm01_00059624 predicted 803
13 SASI_Mm01_00059627 predicted 774
14 SASI_Mm01_00059628 predicted 726
15 SASI_Mm01_00059629 predicted 710
16 SASI_Mm01_00059631 predicted 714
17 SASI_Mm01_00059632 predicted 815
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028334 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00109238 predicted 827
2 SASI_Mm02_00333701 predicted 672
3 SASI_Mm01_00109239 predicted 857
4 SASI_Mm02_00333702 predicted 523
5 SASI_Mm02_00333703 predicted 537
6 SASI_Mm02_00333704 predicted 642
7 SASI_Mm02_00333705 predicted 448
8 SASI_Mm01_00109243 predicted 765
9 SASI_Mm02_00333706 predicted 856
10 SASI_Mm02_00333707 predicted 513
11 SASI_Mm01_00109236 predicted 845
12 SASI_Mm01_00109237 predicted 873
13 SASI_Mm01_00109240 predicted 841
14 SASI_Mm01_00109241 predicted 796
15 SASI_Mm01_00109242 predicted 784
16 SASI_Mm01_00109244 predicted 782
17 SASI_Mm01_00109245 predicted 886
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027191
VALIDATED
NUP37 MISSION shRNA Bacterial Glycerol Stock
nucleoporin 37kDa
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000306784    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027191.2-666s21c1
Sequence:CCGGCCCGAGGAAACTTTCAAGCTACTCGAGTAGCTTGAAAGTTTCCTCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295132    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027191.2-757s21c1
Sequence:CCGGAGTCAGAGCAGACACCCTTAACTCGAGTTAAGGGTGTCTGCTCTGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287649    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027191.2-825s21c1
Sequence:CCGGGCAGGAAATGATTGGATTATTCTCGAGAATAATCCAATCATTTCCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295134    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027191.2-441s21c1
Sequence:CCGGGCTGATTTGAAGATTAGATTACTCGAGTAATCTAATCTTCAAATCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295133    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027191.2-315s21c1
Sequence:CCGGATCGAAGGGATTCAGTATAAACTCGAGTTTATACTGAATCCCTTCGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103785    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027191.1-612s1c1
Sequence:CCGGCGAGGAAACTTTCAAGCTAATCTCGAGATTAGCTTGAAAGTTTCCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103787    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027191.1-610s1c1
Sequence:CCGGCCCGAGGAAACTTTCAAGCTACTCGAGTAGCTTGAAAGTTTCCTCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103786    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027191.1-769s1c1
Sequence:CCGGGCAGGAAATGATTGGATTATTCTCGAGAATAATCCAATCATTTCCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103789    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027191.1-120s1c1
Sequence:CCGGCACCGTGGATTGCGAAGATTACTCGAGTAATCTTCGCAATCCACGGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027191
VALIDATED
NUP37 MISSION shRNA shRNA Plasmid DNA
nucleoporin 37kDa
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000306784    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027191.2-666s21c1
Sequence:CCGGCCCGAGGAAACTTTCAAGCTACTCGAGTAGCTTGAAAGTTTCCTCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000295132    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027191.2-757s21c1
Sequence:CCGGAGTCAGAGCAGACACCCTTAACTCGAGTTAAGGGTGTCTGCTCTGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000287649    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027191.2-825s21c1
Sequence:CCGGGCAGGAAATGATTGGATTATTCTCGAGAATAATCCAATCATTTCCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000295134    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027191.2-441s21c1
Sequence:CCGGGCTGATTTGAAGATTAGATTACTCGAGTAATCTAATCTTCAAATCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000295133    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027191.2-315s21c1
Sequence:CCGGATCGAAGGGATTCAGTATAAACTCGAGTTTATACTGAATCCCTTCGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103785    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027191.1-612s1c1
Sequence:CCGGCGAGGAAACTTTCAAGCTAATCTCGAGATTAGCTTGAAAGTTTCCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103787    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027191.1-610s1c1
Sequence:CCGGCCCGAGGAAACTTTCAAGCTACTCGAGTAGCTTGAAAGTTTCCTCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103786    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027191.1-769s1c1
Sequence:CCGGGCAGGAAATGATTGGATTATTCTCGAGAATAATCCAATCATTTCCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103789    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027191.1-120s1c1
Sequence:CCGGCACCGTGGATTGCGAAGATTACTCGAGTAATCTTCGCAATCCACGGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027191
VALIDATED
NUP37 MISSION shRNA Lentiviral Transduction Particles
nucleoporin 37kDa
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000306784    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027191.2-666s21c1
Sequence:CCGGCCCGAGGAAACTTTCAAGCTACTCGAGTAGCTTGAAAGTTTCCTCGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000295132    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027191.2-757s21c1
Sequence:CCGGAGTCAGAGCAGACACCCTTAACTCGAGTTAAGGGTGTCTGCTCTGACTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000287649    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027191.2-825s21c1
Sequence:CCGGGCAGGAAATGATTGGATTATTCTCGAGAATAATCCAATCATTTCCTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000295134    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027191.2-441s21c1
Sequence:CCGGGCTGATTTGAAGATTAGATTACTCGAGTAATCTAATCTTCAAATCAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000295133    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027191.2-315s21c1
Sequence:CCGGATCGAAGGGATTCAGTATAAACTCGAGTTTATACTGAATCCCTTCGATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103785    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027191.1-612s1c1
Sequence:CCGGCGAGGAAACTTTCAAGCTAATCTCGAGATTAGCTTGAAAGTTTCCTCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103787    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027191.1-610s1c1
Sequence:CCGGCCCGAGGAAACTTTCAAGCTACTCGAGTAGCTTGAAAGTTTCCTCGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103786    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027191.1-769s1c1
Sequence:CCGGGCAGGAAATGATTGGATTATTCTCGAGAATAATCCAATCATTTCCTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103789    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027191.1-120s1c1
Sequence:CCGGCACCGTGGATTGCGAAGATTACTCGAGTAATCTTCGCAATCCACGGTGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024057
VALIDATED
NUP37 MISSION shRNA Bacterial Glycerol Stock
nucleoporin 37kDa
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000280941    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024057.2-678s21c1
Sequence:CCGGGAATCAGAACAAGTGCCATTACTCGAGTAATGGCACTTGTTCTGATTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280871    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_024057.2-620s21c1
Sequence:CCGGGAAGAATGGAACAATCCGGTTCTCGAGAACCGGATTGTTCCATTCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151233    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_024057.2-111s1c1
Sequence:CCGGGAAGATTATGTGCATGTGGTACTCGAGTACCACATGCACATAATCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151312    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024057.2-678s1c1
Sequence:CCGGGAATCAGAACAAGTGCCATTACTCGAGTAATGGCACTTGTTCTGATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152222    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_024057.2-328s1c1
Sequence:CCGGCATTGCCTCCAGTAATCAAATCTCGAGATTTGATTACTGGAGGCAATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153319    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_024057.2-620s1c1
Sequence:CCGGGAAGAATGGAACAATCCGGTTCTCGAGAACCGGATTGTTCCATTCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280938    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_024057.2-328s21c1
Sequence:CCGGCATTGCCTCCAGTAATCAAATCTCGAGATTTGATTACTGGAGGCAATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156008    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_024057.2-219s1c1
Sequence:CCGGCAGGAAGAAGAAGCAGACGTTCTCGAGAACGTCTGCTTCTTCTTCCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280940    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_024057.2-219s21c1
Sequence:CCGGCAGGAAGAAGAAGCAGACGTTCTCGAGAACGTCTGCTTCTTCTTCCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024057
VALIDATED
NUP37 MISSION shRNA shRNA Plasmid DNA
nucleoporin 37kDa
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000280941    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024057.2-678s21c1
Sequence:CCGGGAATCAGAACAAGTGCCATTACTCGAGTAATGGCACTTGTTCTGATTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000280871    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_024057.2-620s21c1
Sequence:CCGGGAAGAATGGAACAATCCGGTTCTCGAGAACCGGATTGTTCCATTCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151233    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_024057.2-111s1c1
Sequence:CCGGGAAGATTATGTGCATGTGGTACTCGAGTACCACATGCACATAATCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151312    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024057.2-678s1c1
Sequence:CCGGGAATCAGAACAAGTGCCATTACTCGAGTAATGGCACTTGTTCTGATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152222    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_024057.2-328s1c1
Sequence:CCGGCATTGCCTCCAGTAATCAAATCTCGAGATTTGATTACTGGAGGCAATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153319    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_024057.2-620s1c1
Sequence:CCGGGAAGAATGGAACAATCCGGTTCTCGAGAACCGGATTGTTCCATTCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000280938    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_024057.2-328s21c1
Sequence:CCGGCATTGCCTCCAGTAATCAAATCTCGAGATTTGATTACTGGAGGCAATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000156008    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_024057.2-219s1c1
Sequence:CCGGCAGGAAGAAGAAGCAGACGTTCTCGAGAACGTCTGCTTCTTCTTCCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000280940    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_024057.2-219s21c1
Sequence:CCGGCAGGAAGAAGAAGCAGACGTTCTCGAGAACGTCTGCTTCTTCTTCCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024057
VALIDATED
NUP37 MISSION shRNA Lentiviral Transduction Particles
nucleoporin 37kDa
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000280941    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024057.2-678s21c1
Sequence:CCGGGAATCAGAACAAGTGCCATTACTCGAGTAATGGCACTTGTTCTGATTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000280871    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_024057.2-620s21c1
Sequence:CCGGGAAGAATGGAACAATCCGGTTCTCGAGAACCGGATTGTTCCATTCTTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151233    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_024057.2-111s1c1
Sequence:CCGGGAAGATTATGTGCATGTGGTACTCGAGTACCACATGCACATAATCTTCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151312    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024057.2-678s1c1
Sequence:CCGGGAATCAGAACAAGTGCCATTACTCGAGTAATGGCACTTGTTCTGATTCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152222    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_024057.2-328s1c1
Sequence:CCGGCATTGCCTCCAGTAATCAAATCTCGAGATTTGATTACTGGAGGCAATGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153319    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_024057.2-620s1c1
Sequence:CCGGGAAGAATGGAACAATCCGGTTCTCGAGAACCGGATTGTTCCATTCTTCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000280938    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_024057.2-328s21c1
Sequence:CCGGCATTGCCTCCAGTAATCAAATCTCGAGATTTGATTACTGGAGGCAATGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000156008    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_024057.2-219s1c1
Sequence:CCGGCAGGAAGAAGAAGCAGACGTTCTCGAGAACGTCTGCTTCTTCTTCCTGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000280940    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_024057.2-219s21c1
Sequence:CCGGCAGGAAGAAGAAGCAGACGTTCTCGAGAACGTCTGCTTCTTCTTCCTGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)