EMAIL THIS PAGE TO A FRIEND

NUP54

nucleoporin 54kDa

105 Gene Product Result for
UniProtKB ID: Q7Z3B4, B2RCK7, Q96EA7, Q9NVL5, Q9P0I1
Gene ID:
Human(53371) Summary: The nuclear envelope creates distinct nuclear and cytoplasmic compartments in eukaryotic cells. It consists of two concentric membranes perforated by nuclear pores, large protein complexes that form aqueous channels to regulate the flow of macromolecules between the nucleus and the cytoplasm. These complexes are composed of at least 100 different polypeptide subunits, many of which belong to the nucleoporin family. This gene encodes a member of the phe-gly (FG) repeat-containing nucleoporin subset. Multiple alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jun 2013]
Mouse(269113) nucleoporin 54
Rat(53372) nucleoporin 54
fruit fly(36360) Nucleoporin 54
cow(506916) nucleoporin 54kDa
dog(487813) nucleoporin 54kDa
Zebrafish(335750) nucleoporin 54
chicken(422639) nucleoporin 54kDa
naked mole-rat(101716369) nucleoporin 54kDa
domestic guinea pig(100715738) nucleoporin 54kDa
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_183392 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_183392 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_183392 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_017426 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017426 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017426 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017426 Rosetta Predictions human pricing
NM_017361 Rosetta Predictions rat pricing
NM_183392 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017426 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00158535 predicted 274
2 SASI_Hs01_00158536 predicted 1165
3 SASI_Hs01_00158537 predicted 1359
4 SASI_Hs01_00158538 predicted 954
5 SASI_Hs01_00158539 predicted 1372
6 SASI_Hs01_00158540 predicted 1657
7 SASI_Hs01_00158541 predicted 947
8 SASI_Hs01_00158542 predicted 1651
9 SASI_Hs01_00158543 predicted 1404
10 SASI_Hs02_00350000 predicted 747
11 SASI_Hs01_00158534 predicted 554
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017361 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00118524 predicted 857
2 SASI_Rn01_00118525 predicted 587
3 SASI_Rn01_00118526 predicted 1452
4 SASI_Rn01_00118527 predicted 1444
5 SASI_Rn01_00118528 predicted 1345
6 SASI_Rn02_00261852 predicted 1042
7 SASI_Rn01_00118529 predicted 1166
8 SASI_Rn01_00118530 predicted 812
9 SASI_Rn01_00118531 predicted 1140
10 SASI_Rn02_00261853 predicted 698
11 SASI_Rn01_00118532 predicted 1556
12 SASI_Rn01_00118533 predicted 677
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_183392 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00350506 predicted 1669
2 SASI_Mm01_00174140 predicted 916
3 SASI_Mm02_00350507 predicted 1666
4 SASI_Mm01_00174141 predicted 924
5 SASI_Mm01_00174142 predicted 805
6 SASI_Mm01_00174143 predicted 875
7 SASI_Mm01_00174144 predicted 1222
8 SASI_Mm01_00174145 predicted 1106
9 SASI_Mm01_00174146 predicted 822
10 SASI_Mm01_00174147 predicted 801
11 SASI_Mm01_00174148 predicted 692
12 SASI_Mm01_00174149 predicted 679
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_183392
VALIDATED
NUP54 MISSION shRNA Bacterial Glycerol Stock
nucleoporin 54kDa
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000102205    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_183392.1-1968s1c1
Sequence:CCGGGCTGTGCTTCAGGGTATAAATCTCGAGATTTATACCCTGAAGCACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102206    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183392.1-1487s1c1
Sequence:CCGGGCCACTTGATTAGCATCATAACTCGAGTTATGATGCTAATCAAGTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102209    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_183392.1-1294s1c1
Sequence:CCGGCGGGTTCAGCTAGATACTATTCTCGAGAATAGTATCTAGCTGAACCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102207    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183392.1-965s1c1
Sequence:CCGGCCGCAGGTGTTGATCCTATTACTCGAGTAATAGGATCAACACCTGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000349856    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_183392.2-847s21c1
Sequence:CCGGCAGACGGAAGTTGTCATTTATCTCGAGATAAATGACAACTTCCGTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312091    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_183392.2-1369s21c1
Sequence:CCGGCGGGTTCAGCTAGATACTATTCTCGAGAATAGTATCTAGCTGAACCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312987    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183392.2-1041s21c1
Sequence:CCGGCGCAGGTGTTGATCCTATTATCTCGAGATAATAGGATCAACACCTGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313033    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_183392.2-670s21c1
Sequence:CCGGTATAGTTGTATGCCCAATAATCTCGAGATTATTGGGCATACAACTATATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313035    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_183392.2-1786s21c1
Sequence:CCGGAGAGGTTACTGTACGTTAAATCTCGAGATTTAACGTACAGTAACCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_183392
VALIDATED
NUP54 MISSION shRNA shRNA Plasmid DNA
nucleoporin 54kDa
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000102205    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_183392.1-1968s1c1
Sequence:CCGGGCTGTGCTTCAGGGTATAAATCTCGAGATTTATACCCTGAAGCACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102206    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183392.1-1487s1c1
Sequence:CCGGGCCACTTGATTAGCATCATAACTCGAGTTATGATGCTAATCAAGTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102209    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_183392.1-1294s1c1
Sequence:CCGGCGGGTTCAGCTAGATACTATTCTCGAGAATAGTATCTAGCTGAACCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102207    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183392.1-965s1c1
Sequence:CCGGCCGCAGGTGTTGATCCTATTACTCGAGTAATAGGATCAACACCTGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000349856    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_183392.2-847s21c1
Sequence:CCGGCAGACGGAAGTTGTCATTTATCTCGAGATAAATGACAACTTCCGTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000312091    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_183392.2-1369s21c1
Sequence:CCGGCGGGTTCAGCTAGATACTATTCTCGAGAATAGTATCTAGCTGAACCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000312987    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183392.2-1041s21c1
Sequence:CCGGCGCAGGTGTTGATCCTATTATCTCGAGATAATAGGATCAACACCTGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000313033    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_183392.2-670s21c1
Sequence:CCGGTATAGTTGTATGCCCAATAATCTCGAGATTATTGGGCATACAACTATATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000313035    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_183392.2-1786s21c1
Sequence:CCGGAGAGGTTACTGTACGTTAAATCTCGAGATTTAACGTACAGTAACCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_183392
VALIDATED
NUP54 MISSION shRNA Lentiviral Transduction Particles
nucleoporin 54kDa
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000102205    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_183392.1-1968s1c1
Sequence:CCGGGCTGTGCTTCAGGGTATAAATCTCGAGATTTATACCCTGAAGCACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102206    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183392.1-1487s1c1
Sequence:CCGGGCCACTTGATTAGCATCATAACTCGAGTTATGATGCTAATCAAGTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102209    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_183392.1-1294s1c1
Sequence:CCGGCGGGTTCAGCTAGATACTATTCTCGAGAATAGTATCTAGCTGAACCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102207    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183392.1-965s1c1
Sequence:CCGGCCGCAGGTGTTGATCCTATTACTCGAGTAATAGGATCAACACCTGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000349856    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_183392.2-847s21c1
Sequence:CCGGCAGACGGAAGTTGTCATTTATCTCGAGATAAATGACAACTTCCGTCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312091    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_183392.2-1369s21c1
Sequence:CCGGCGGGTTCAGCTAGATACTATTCTCGAGAATAGTATCTAGCTGAACCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312987    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183392.2-1041s21c1
Sequence:CCGGCGCAGGTGTTGATCCTATTATCTCGAGATAATAGGATCAACACCTGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313033    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_183392.2-670s21c1
Sequence:CCGGTATAGTTGTATGCCCAATAATCTCGAGATTATTGGGCATACAACTATATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313035    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_183392.2-1786s21c1
Sequence:CCGGAGAGGTTACTGTACGTTAAATCTCGAGATTTAACGTACAGTAACCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017426
VALIDATED
NUP54 MISSION shRNA Bacterial Glycerol Stock
nucleoporin 54kDa
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000059907    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_017426.2-1166s1c1
Sequence:CCGGGCATCAAACCAGATTAGATATCTCGAGATATCTAATCTGGTTTGATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059906    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_017426.2-871s1c1
Sequence:CCGGCGCCAAATGGTACTTCAAGAACTCGAGTTCTTGAAGTACCATTTGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059905    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_017426.2-1552s1c1
Sequence:CCGGGCCATTTGATTAGCATCATTACTCGAGTAATGATGCTAATCAAATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059903    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_017426.2-1063s1c1
Sequence:CCGGCCAAGGTAGATAACCCTGATTCTCGAGAATCAGGGTTATCTACCTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059904    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017426.2-640s1c1
Sequence:CCGGGCCGATTTAAGGCAGTAGGTTCTCGAGAACCTACTGCCTTAAATCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293960    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017426.2-662s21c1
Sequence:CCGGTAGTTGCATGCCCAGTAATAACTCGAGTTATTACTGGGCATGCAACTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286570    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017426.2-1063s21c1
Sequence:CCGGCCAAGGTAGATAACCCTGATTCTCGAGAATCAGGGTTATCTACCTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286503    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017426.2-1552s21c1
Sequence:CCGGGCCATTTGATTAGCATCATTACTCGAGTAATGATGCTAATCAAATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286569    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017426.2-871s21c1
Sequence:CCGGCGCCAAATGGTACTTCAAGAACTCGAGTTCTTGAAGTACCATTTGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293959    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017426.2-1991s21c1
Sequence:CCGGCTGCTTTCCATACCAAGTAAACTCGAGTTTACTTGGTATGGAAAGCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017426
VALIDATED
NUP54 MISSION shRNA shRNA Plasmid DNA
nucleoporin 54kDa
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000059907    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_017426.2-1166s1c1
Sequence:CCGGGCATCAAACCAGATTAGATATCTCGAGATATCTAATCTGGTTTGATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059906    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_017426.2-871s1c1
Sequence:CCGGCGCCAAATGGTACTTCAAGAACTCGAGTTCTTGAAGTACCATTTGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059905    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_017426.2-1552s1c1
Sequence:CCGGGCCATTTGATTAGCATCATTACTCGAGTAATGATGCTAATCAAATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059903    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_017426.2-1063s1c1
Sequence:CCGGCCAAGGTAGATAACCCTGATTCTCGAGAATCAGGGTTATCTACCTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059904    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017426.2-640s1c1
Sequence:CCGGGCCGATTTAAGGCAGTAGGTTCTCGAGAACCTACTGCCTTAAATCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000293960    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017426.2-662s21c1
Sequence:CCGGTAGTTGCATGCCCAGTAATAACTCGAGTTATTACTGGGCATGCAACTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000286570    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017426.2-1063s21c1
Sequence:CCGGCCAAGGTAGATAACCCTGATTCTCGAGAATCAGGGTTATCTACCTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000286503    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017426.2-1552s21c1
Sequence:CCGGGCCATTTGATTAGCATCATTACTCGAGTAATGATGCTAATCAAATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000286569    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017426.2-871s21c1
Sequence:CCGGCGCCAAATGGTACTTCAAGAACTCGAGTTCTTGAAGTACCATTTGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000293959    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017426.2-1991s21c1
Sequence:CCGGCTGCTTTCCATACCAAGTAAACTCGAGTTTACTTGGTATGGAAAGCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017426
VALIDATED
NUP54 MISSION shRNA Lentiviral Transduction Particles
nucleoporin 54kDa
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000059907    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_017426.2-1166s1c1
Sequence:CCGGGCATCAAACCAGATTAGATATCTCGAGATATCTAATCTGGTTTGATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059906    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_017426.2-871s1c1
Sequence:CCGGCGCCAAATGGTACTTCAAGAACTCGAGTTCTTGAAGTACCATTTGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059905    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_017426.2-1552s1c1
Sequence:CCGGGCCATTTGATTAGCATCATTACTCGAGTAATGATGCTAATCAAATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059903    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_017426.2-1063s1c1
Sequence:CCGGCCAAGGTAGATAACCCTGATTCTCGAGAATCAGGGTTATCTACCTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059904    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017426.2-640s1c1
Sequence:CCGGGCCGATTTAAGGCAGTAGGTTCTCGAGAACCTACTGCCTTAAATCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293960    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017426.2-662s21c1
Sequence:CCGGTAGTTGCATGCCCAGTAATAACTCGAGTTATTACTGGGCATGCAACTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286570    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017426.2-1063s21c1
Sequence:CCGGCCAAGGTAGATAACCCTGATTCTCGAGAATCAGGGTTATCTACCTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286503    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017426.2-1552s21c1
Sequence:CCGGGCCATTTGATTAGCATCATTACTCGAGTAATGATGCTAATCAAATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286569    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017426.2-871s21c1
Sequence:CCGGCGCCAAATGGTACTTCAAGAACTCGAGTTCTTGAAGTACCATTTGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293959    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017426.2-1991s21c1
Sequence:CCGGCTGCTTTCCATACCAAGTAAACTCGAGTTTACTTGGTATGGAAAGCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)