EMAIL THIS PAGE TO A FRIEND

NUP62CL

nucleoporin 62kDa C-terminal like

110 Gene Product Result for
UniProtKB ID: Q9H1M0, D3DUX4, Q8WVL6, Q9NXP2
Gene ID:
Human(54830) Summary: This gene encodes a protein containing a domain found in nucleoporins which are glycoproteins found in nuclear pore complexes. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2011]
Mouse(279706) nucleoporin 62 C-terminal like
Rat(300923) nucleoporin 62 C-terminal like
dog(610319) nucleoporin 62kDa C-terminal like
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_017681 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017681 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017681 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001081668 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081668 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081668 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017681 Rosetta Predictions human pricing
XM_001053696 Rosetta Predictions rat pricing
XM_217225 Rosetta Predictions rat pricing
XM_205358 Rosetta Predictions mouse pricing
XM_907647 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017681 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00043380 predicted 563
2 SASI_Hs01_00043382 predicted 942
3 SASI_Hs02_00350431 predicted 897
4 SASI_Hs01_00043383 predicted 1036
5 SASI_Hs01_00043384 predicted 448
6 SASI_Hs01_00043385 predicted 798
7 SASI_Hs01_00043386 predicted 1039
8 SASI_Hs01_00043387 predicted 593
9 SASI_Hs02_00350432 predicted 566
10 SASI_Hs01_00043388 predicted 633
11 SASI_Hs01_00043381 predicted 891
12 SASI_Hs01_00043389 predicted 699
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001053696 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00273259 predicted 342
2 SASI_Rn02_00273260 predicted 691
3 SASI_Rn02_00273261 predicted 1053
4 SASI_Rn02_00273262 predicted 842
5 SASI_Rn02_00273263 predicted 714
6 SASI_Rn02_00273264 predicted 369
7 SASI_Rn02_00273265 predicted 1008
8 SASI_Rn02_00273266 predicted 533
9 SASI_Rn02_00273267 predicted 1078
10 SASI_Rn02_00273268 predicted 332
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_217225 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00377070 predicted 346
2 SASI_Rn02_00377071 predicted 687
3 SASI_Rn02_00377072 predicted 1051
4 SASI_Rn02_00377073 predicted 842
5 SASI_Rn02_00377074 predicted 709
6 SASI_Rn02_00377075 predicted 369
7 SASI_Rn02_00377076 predicted 1007
8 SASI_Rn02_00377077 predicted 531
9 SASI_Rn02_00377078 predicted 1078
10 SASI_Rn02_00377079 predicted 330
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_205358 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00222415 predicted 489
2 SASI_Mm01_00222416 predicted 729
3 SASI_Mm01_00222417 predicted 578
4 SASI_Mm01_00222418 predicted 570
5 SASI_Mm01_00222419 predicted 648
6 SASI_Mm01_00222420 predicted 685
7 SASI_Mm01_00222421 predicted 474
8 SASI_Mm01_00222422 predicted 749
9 SASI_Mm01_00222423 predicted 444
10 SASI_Mm01_00222424 predicted 763
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_907647 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00433426 predicted 489
2 SASI_Mm02_00433427 predicted 720
3 SASI_Mm02_00433428 predicted 577
4 SASI_Mm02_00433429 predicted 568
5 SASI_Mm02_00433430 predicted 648
6 SASI_Mm02_00433431 predicted 684
7 SASI_Mm02_00433432 predicted 477
8 SASI_Mm02_00433433 predicted 749
9 SASI_Mm02_00433434 predicted 451
10 SASI_Mm02_00433435 predicted 764
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017681
VALIDATED
NUP62CL MISSION shRNA Bacterial Glycerol Stock
nucleoporin 62kDa C-terminal like
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000142708    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017681.1-1114s1c1
Sequence:CCGGCCAGTTGAATCATAGGGTGATCTCGAGATCACCCTATGATTCAACTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142709    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017681.1-274s1c1
Sequence:CCGGCCAACTGTTATCAAGAGGGTTCTCGAGAACCCTCTTGATAACAGTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142056    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_017681.1-1505s1c1
Sequence:CCGGGCCTTGTTCTTAGGTTTGGAACTCGAGTTCCAAACCTAAGAACAAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141873    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017681.1-443s1c1
Sequence:CCGGGCTTGGGACCATACATTGATTCTCGAGAATCAATGTATGGTCCCAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141346    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017681.1-560s1c1
Sequence:CCGGCAGCAGCAGGAACTAGAATTTCTCGAGAAATTCTAGTTCCTGCTGCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139191    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017681.1-240s1c1
Sequence:CCGGCCACAATCACCAGTGGCTTTACTCGAGTAAAGCCACTGGTGATTGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139605    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_017681.1-1027s1c1
Sequence:CCGGCCAGACAGCAACCTCTTAGATCTCGAGATCTAAGAGGTTGCTGTCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142104    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017681.1-335s1c1
Sequence:CCGGGCAACTCCTGTGATGACATATCTCGAGATATGTCATCACAGGAGTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142678    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017681.1-626s1c1
Sequence:CCGGCATTATCTGCAGGATGCAGATCTCGAGATCTGCATCCTGCAGATAATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145570    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_017681.1-841s1c1
Sequence:CCGGGCATGTCGTTTCTGGATTATTCTCGAGAATAATCCAGAAACGACATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145275    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017681.1-460s1c1
Sequence:CCGGGATTGAGAATGGTGAGATGATCTCGAGATCATCTCACCATTCTCAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144059    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017681.1-278s1c1
Sequence:CCGGCTGTTATCAAGAGGGTTTGAACTCGAGTTCAAACCCTCTTGATAACAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144610    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017681.1-466s1c1
Sequence:CCGGGAATGGTGAGATGATTCGTATCTCGAGATACGAATCATCTCACCATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017681
VALIDATED
NUP62CL MISSION shRNA shRNA Plasmid DNA
nucleoporin 62kDa C-terminal like
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000142708    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017681.1-1114s1c1
Sequence:CCGGCCAGTTGAATCATAGGGTGATCTCGAGATCACCCTATGATTCAACTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142709    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017681.1-274s1c1
Sequence:CCGGCCAACTGTTATCAAGAGGGTTCTCGAGAACCCTCTTGATAACAGTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142056    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_017681.1-1505s1c1
Sequence:CCGGGCCTTGTTCTTAGGTTTGGAACTCGAGTTCCAAACCTAAGAACAAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141873    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017681.1-443s1c1
Sequence:CCGGGCTTGGGACCATACATTGATTCTCGAGAATCAATGTATGGTCCCAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141346    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017681.1-560s1c1
Sequence:CCGGCAGCAGCAGGAACTAGAATTTCTCGAGAAATTCTAGTTCCTGCTGCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139191    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017681.1-240s1c1
Sequence:CCGGCCACAATCACCAGTGGCTTTACTCGAGTAAAGCCACTGGTGATTGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139605    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_017681.1-1027s1c1
Sequence:CCGGCCAGACAGCAACCTCTTAGATCTCGAGATCTAAGAGGTTGCTGTCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142104    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017681.1-335s1c1
Sequence:CCGGGCAACTCCTGTGATGACATATCTCGAGATATGTCATCACAGGAGTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142678    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017681.1-626s1c1
Sequence:CCGGCATTATCTGCAGGATGCAGATCTCGAGATCTGCATCCTGCAGATAATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000145570    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_017681.1-841s1c1
Sequence:CCGGGCATGTCGTTTCTGGATTATTCTCGAGAATAATCCAGAAACGACATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000145275    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017681.1-460s1c1
Sequence:CCGGGATTGAGAATGGTGAGATGATCTCGAGATCATCTCACCATTCTCAATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144059    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017681.1-278s1c1
Sequence:CCGGCTGTTATCAAGAGGGTTTGAACTCGAGTTCAAACCCTCTTGATAACAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144610    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017681.1-466s1c1
Sequence:CCGGGAATGGTGAGATGATTCGTATCTCGAGATACGAATCATCTCACCATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017681
VALIDATED
NUP62CL MISSION shRNA Lentiviral Transduction Particles
nucleoporin 62kDa C-terminal like
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000142708    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017681.1-1114s1c1
Sequence:CCGGCCAGTTGAATCATAGGGTGATCTCGAGATCACCCTATGATTCAACTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142709    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017681.1-274s1c1
Sequence:CCGGCCAACTGTTATCAAGAGGGTTCTCGAGAACCCTCTTGATAACAGTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142056    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_017681.1-1505s1c1
Sequence:CCGGGCCTTGTTCTTAGGTTTGGAACTCGAGTTCCAAACCTAAGAACAAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141873    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017681.1-443s1c1
Sequence:CCGGGCTTGGGACCATACATTGATTCTCGAGAATCAATGTATGGTCCCAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141346    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017681.1-560s1c1
Sequence:CCGGCAGCAGCAGGAACTAGAATTTCTCGAGAAATTCTAGTTCCTGCTGCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139191    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017681.1-240s1c1
Sequence:CCGGCCACAATCACCAGTGGCTTTACTCGAGTAAAGCCACTGGTGATTGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139605    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_017681.1-1027s1c1
Sequence:CCGGCCAGACAGCAACCTCTTAGATCTCGAGATCTAAGAGGTTGCTGTCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142104    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017681.1-335s1c1
Sequence:CCGGGCAACTCCTGTGATGACATATCTCGAGATATGTCATCACAGGAGTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142678    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017681.1-626s1c1
Sequence:CCGGCATTATCTGCAGGATGCAGATCTCGAGATCTGCATCCTGCAGATAATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145570    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_017681.1-841s1c1
Sequence:CCGGGCATGTCGTTTCTGGATTATTCTCGAGAATAATCCAGAAACGACATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145275    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017681.1-460s1c1
Sequence:CCGGGATTGAGAATGGTGAGATGATCTCGAGATCATCTCACCATTCTCAATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144059    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017681.1-278s1c1
Sequence:CCGGCTGTTATCAAGAGGGTTTGAACTCGAGTTCAAACCCTCTTGATAACAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144610    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017681.1-466s1c1
Sequence:CCGGGAATGGTGAGATGATTCGTATCTCGAGATACGAATCATCTCACCATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081668
NUP62CL MISSION shRNA Bacterial Glycerol Stock
nucleoporin 62kDa C-terminal like
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000346832    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081668.1-299s21c1
Sequence:CCGGCCAACACCACTACCACGATTACTCGAGTAATCGTGGTAGTGGTGTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000346831    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081668.1-368s21c1
Sequence:CCGGATAACACTGGCTTGATCAATGCTCGAGCATTGATCAAGCCAGTGTTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000346833    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081668.1-807s21c1
Sequence:CCGGTCTCAAGGACATCGTTGTTTACTCGAGTAAACAACGATGTCCTTGAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000346830    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081668.1-921s21c1
Sequence:CCGGTAACCTTAATTCAGGCGTAATCTCGAGATTACGCCTGAATTAAGGTTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081668
NUP62CL MISSION shRNA shRNA Plasmid DNA
nucleoporin 62kDa C-terminal like
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000346832    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081668.1-299s21c1
Sequence:CCGGCCAACACCACTACCACGATTACTCGAGTAATCGTGGTAGTGGTGTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000346831    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081668.1-368s21c1
Sequence:CCGGATAACACTGGCTTGATCAATGCTCGAGCATTGATCAAGCCAGTGTTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000346833    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081668.1-807s21c1
Sequence:CCGGTCTCAAGGACATCGTTGTTTACTCGAGTAAACAACGATGTCCTTGAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000346830    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081668.1-921s21c1
Sequence:CCGGTAACCTTAATTCAGGCGTAATCTCGAGATTACGCCTGAATTAAGGTTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081668
NUP62CL MISSION shRNA Lentiviral Transduction Particles
nucleoporin 62kDa C-terminal like
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000346832    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081668.1-299s21c1
Sequence:CCGGCCAACACCACTACCACGATTACTCGAGTAATCGTGGTAGTGGTGTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000346831    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081668.1-368s21c1
Sequence:CCGGATAACACTGGCTTGATCAATGCTCGAGCATTGATCAAGCCAGTGTTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000346833    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081668.1-807s21c1
Sequence:CCGGTCTCAAGGACATCGTTGTTTACTCGAGTAAACAACGATGTCCTTGAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000346830    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081668.1-921s21c1
Sequence:CCGGTAACCTTAATTCAGGCGTAATCTCGAGATTACGCCTGAATTAAGGTTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)