EMAIL THIS PAGE TO A FRIEND

NUP85

nucleoporin 85kDa

59 Gene Product Result for
Synonyms: Nup75
UniProtKB ID: Q9BW27, Q8NDI4, Q9H9U1
Gene ID:
Human(79902) Summary: Bidirectional transport of macromolecules between the cytoplasm and nucleus occurs through nuclear pore complexes (NPCs) embedded in the nuclear envelope. NPCs are composed of subcomplexes, and NUP85 is part of one such subcomplex, Nup107-160. [provided by RefSeq, Jul 2008]
Mouse(445007) nucleoporin 85
Rat(287830) nucleoporin 85
Zebrafish(445231) nucleoporin 85
cow(510540) nucleoporin 85kDa
Horse(100052049) nucleoporin 85kDa
domestic cat(101098345) nucleoporin 85kDa
dog(475913) nucleoporin 85kDa
chicken(422120) nucleoporin 85kDa
domestic guinea pig(100713777) nucleoporin 85kDa
naked mole-rat(101712108) nucleoporin 85kDa
sheep(101110856) nucleoporin 85kDa
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024844 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024844 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024844 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001002929 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001002929 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001002929 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024844 siRNAs that have been validated in the lab human pricing
NM_001025401 Rosetta Predictions rat pricing
NM_001002929 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024844 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00181542 validated 1652
2 SASI_Hs02_00357417 predicted 1133
3 SASI_Hs01_00181544 predicted 674
4 SASI_Hs01_00181546 predicted 1660
5 SASI_Hs01_00181547 predicted 1648
6 SASI_Hs01_00181548 predicted 283
7 SASI_Hs01_00181549 predicted 1516
8 SASI_Hs01_00181550 predicted 1195
9 SASI_Hs02_00357418 predicted 1582
10 SASI_Hs02_00357419 predicted 354
11 SASI_Hs01_00181543 predicted 1858
12 SASI_Hs01_00181545 predicted 310
13 SASI_Hs01_00181551 predicted 810
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025401 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00203132 predicted 1361
2 SASI_Rn01_00116594 predicted 1135
3 SASI_Rn01_00116595 predicted 440
4 SASI_Rn01_00116598 predicted 276
5 SASI_Rn01_00116599 predicted 1411
6 SASI_Rn01_00116600 predicted 656
7 SASI_Rn01_00116601 predicted 560
8 SASI_Rn02_00203133 predicted 1060
9 SASI_Rn01_00116603 predicted 1074
10 SASI_Rn02_00203134 predicted 1426
11 SASI_Rn01_00116596 predicted 285
12 SASI_Rn01_00116597 predicted 1209
13 SASI_Rn01_00116602 predicted 1283
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001002929 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00142169 predicted 624
2 SASI_Mm01_00142170 predicted 1192
3 SASI_Mm02_00286314 predicted 310
4 SASI_Mm01_00142172 predicted 372
5 SASI_Mm01_00142173 predicted 262
6 SASI_Mm01_00142174 predicted 1675
7 SASI_Mm01_00142175 predicted 527
8 SASI_Mm01_00142176 predicted 885
9 SASI_Mm01_00142177 predicted 1463
10 SASI_Mm01_00142178 predicted 1494
11 SASI_Mm01_00142171 predicted 1150
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024844
VALIDATED
NUP85 MISSION shRNA Bacterial Glycerol Stock
nucleoporin 85kDa
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000327768    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024844.3-1221s21c1
Sequence:CCGGCCCATTGATCTGCACTACTATCTCGAGATAGTAGTGCAGATCAATGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312690    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024844.3-431s21c1
Sequence:CCGGCCGTAAGGATGTAGATGTTTACTCGAGTAAACATCTACATCCTTACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312635    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024844.3-1160s21c1
Sequence:CCGGTCTGAGTAATTGGTATCATTTCTCGAGAAATGATACCAATTACTCAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312633    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024844.3-1684s21c1
Sequence:CCGGTGAAAGCCGTCCGCAACAATCCTCGAGGATTGTTGCGGACGGCTTTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312694    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024844.3-549s21c1
Sequence:CCGGCAATTGGTTCGAGTGAGTAAACTCGAGTTTACTCACTCGAACCAATTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072403    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024844.2-435s1c1
Sequence:CCGGGCTGCTAAAGATCCAGCCAATCTCGAGATTGGCTGGATCTTTAGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072405    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024844.2-948s1c1
Sequence:CCGGGCCTTGTTAGAGCAGAAGGAACTCGAGTTCCTTCTGCTCTAACAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072406    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024844.2-1253s1c1
Sequence:CCGGCGGTTCCAACATGAGAGAGTTCTCGAGAACTCTCTCATGTTGGAACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072404    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024844.2-1032s1c1
Sequence:CCGGCCCATTGATCTGCACTACTATCTCGAGATAGTAGTGCAGATCAATGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072407    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024844.2-961s1c1
Sequence:CCGGAGAAGGAACTTCTGAGTAATTCTCGAGAATTACTCAGAAGTTCCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024844
VALIDATED
NUP85 MISSION shRNA shRNA Plasmid DNA
nucleoporin 85kDa
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000327768    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024844.3-1221s21c1
Sequence:CCGGCCCATTGATCTGCACTACTATCTCGAGATAGTAGTGCAGATCAATGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000312690    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024844.3-431s21c1
Sequence:CCGGCCGTAAGGATGTAGATGTTTACTCGAGTAAACATCTACATCCTTACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000312635    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024844.3-1160s21c1
Sequence:CCGGTCTGAGTAATTGGTATCATTTCTCGAGAAATGATACCAATTACTCAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000312633    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024844.3-1684s21c1
Sequence:CCGGTGAAAGCCGTCCGCAACAATCCTCGAGGATTGTTGCGGACGGCTTTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000312694    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024844.3-549s21c1
Sequence:CCGGCAATTGGTTCGAGTGAGTAAACTCGAGTTTACTCACTCGAACCAATTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072403    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024844.2-435s1c1
Sequence:CCGGGCTGCTAAAGATCCAGCCAATCTCGAGATTGGCTGGATCTTTAGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072405    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024844.2-948s1c1
Sequence:CCGGGCCTTGTTAGAGCAGAAGGAACTCGAGTTCCTTCTGCTCTAACAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072406    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024844.2-1253s1c1
Sequence:CCGGCGGTTCCAACATGAGAGAGTTCTCGAGAACTCTCTCATGTTGGAACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072404    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024844.2-1032s1c1
Sequence:CCGGCCCATTGATCTGCACTACTATCTCGAGATAGTAGTGCAGATCAATGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072407    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024844.2-961s1c1
Sequence:CCGGAGAAGGAACTTCTGAGTAATTCTCGAGAATTACTCAGAAGTTCCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024844
VALIDATED
NUP85 MISSION shRNA Lentiviral Transduction Particles
nucleoporin 85kDa
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000327768    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024844.3-1221s21c1
Sequence:CCGGCCCATTGATCTGCACTACTATCTCGAGATAGTAGTGCAGATCAATGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312690    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024844.3-431s21c1
Sequence:CCGGCCGTAAGGATGTAGATGTTTACTCGAGTAAACATCTACATCCTTACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312635    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024844.3-1160s21c1
Sequence:CCGGTCTGAGTAATTGGTATCATTTCTCGAGAAATGATACCAATTACTCAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312633    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024844.3-1684s21c1
Sequence:CCGGTGAAAGCCGTCCGCAACAATCCTCGAGGATTGTTGCGGACGGCTTTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312694    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024844.3-549s21c1
Sequence:CCGGCAATTGGTTCGAGTGAGTAAACTCGAGTTTACTCACTCGAACCAATTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072403    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024844.2-435s1c1
Sequence:CCGGGCTGCTAAAGATCCAGCCAATCTCGAGATTGGCTGGATCTTTAGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072405    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024844.2-948s1c1
Sequence:CCGGGCCTTGTTAGAGCAGAAGGAACTCGAGTTCCTTCTGCTCTAACAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072406    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024844.2-1253s1c1
Sequence:CCGGCGGTTCCAACATGAGAGAGTTCTCGAGAACTCTCTCATGTTGGAACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072404    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024844.2-1032s1c1
Sequence:CCGGCCCATTGATCTGCACTACTATCTCGAGATAGTAGTGCAGATCAATGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072407    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024844.2-961s1c1
Sequence:CCGGAGAAGGAACTTCTGAGTAATTCTCGAGAATTACTCAGAAGTTCCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001002929
VALIDATED
NUP85 MISSION shRNA Bacterial Glycerol Stock
nucleoporin 85kDa
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000318027    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_001002929.3-527s21c1
Sequence:CCGGCCTGTGTGAGATTCTCTTTATCTCGAGATAAAGAGAATCTCACACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317957    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_001002929.3-267s21c1
Sequence:CCGGGTGGATGTTTACTCTCAAATTCTCGAGAATTTGAGAGTAAACATCCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314161    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_001002929.3-1508s21c1
Sequence:CCGGCATGAAGGCTGTTCGTAATAACTCGAGTTATTACGAACAGCCTTCATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314160    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_001002929.3-1467s21c1
Sequence:CCGGCAGATGACTGAGCAAGTTAAACTCGAGTTTAACTTGCTCAGTCATCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317959    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_001002929.3-1247s21c1
Sequence:CCGGCCAGTCACACAATCTCTATTTCTCGAGAAATAGAGATTGTGTGACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126742    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_001002929.2-492s1c1
Sequence:CCGGCCTGTGTGAGATTCTCTTTATCTCGAGATAAAGAGAATCTCACACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126740    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_001002929.2-232s1c1
Sequence:CCGGGTGGATGTTTACTCTCAAATTCTCGAGAATTTGAGAGTAAACATCCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126741    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_001002929.2-1212s1c1
Sequence:CCGGCCAGTCACACAATCTCTATTTCTCGAGAAATAGAGATTGTGTGACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126739    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_001002929.2-2025s1c1
Sequence:CCGGGAAGATGAGGACAGTTGCAATCTCGAGATTGCAACTGTCCTCATCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126743    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002929.2-93s1c1
Sequence:CCGGAGGTGTGAATTCCAAGAAGAACTCGAGTTCTTCTTGGAATTCACACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001002929
VALIDATED
NUP85 MISSION shRNA shRNA Plasmid DNA
nucleoporin 85kDa
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000318027    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_001002929.3-527s21c1
Sequence:CCGGCCTGTGTGAGATTCTCTTTATCTCGAGATAAAGAGAATCTCACACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000317957    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_001002929.3-267s21c1
Sequence:CCGGGTGGATGTTTACTCTCAAATTCTCGAGAATTTGAGAGTAAACATCCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000314161    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_001002929.3-1508s21c1
Sequence:CCGGCATGAAGGCTGTTCGTAATAACTCGAGTTATTACGAACAGCCTTCATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000314160    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_001002929.3-1467s21c1
Sequence:CCGGCAGATGACTGAGCAAGTTAAACTCGAGTTTAACTTGCTCAGTCATCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000317959    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_001002929.3-1247s21c1
Sequence:CCGGCCAGTCACACAATCTCTATTTCTCGAGAAATAGAGATTGTGTGACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000126742    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_001002929.2-492s1c1
Sequence:CCGGCCTGTGTGAGATTCTCTTTATCTCGAGATAAAGAGAATCTCACACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000126740    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_001002929.2-232s1c1
Sequence:CCGGGTGGATGTTTACTCTCAAATTCTCGAGAATTTGAGAGTAAACATCCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000126741    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_001002929.2-1212s1c1
Sequence:CCGGCCAGTCACACAATCTCTATTTCTCGAGAAATAGAGATTGTGTGACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000126739    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_001002929.2-2025s1c1
Sequence:CCGGGAAGATGAGGACAGTTGCAATCTCGAGATTGCAACTGTCCTCATCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000126743    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002929.2-93s1c1
Sequence:CCGGAGGTGTGAATTCCAAGAAGAACTCGAGTTCTTCTTGGAATTCACACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001002929
VALIDATED
NUP85 MISSION shRNA Lentiviral Transduction Particles
nucleoporin 85kDa
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000318027    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_001002929.3-527s21c1
Sequence:CCGGCCTGTGTGAGATTCTCTTTATCTCGAGATAAAGAGAATCTCACACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317957    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_001002929.3-267s21c1
Sequence:CCGGGTGGATGTTTACTCTCAAATTCTCGAGAATTTGAGAGTAAACATCCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314161    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_001002929.3-1508s21c1
Sequence:CCGGCATGAAGGCTGTTCGTAATAACTCGAGTTATTACGAACAGCCTTCATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314160    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_001002929.3-1467s21c1
Sequence:CCGGCAGATGACTGAGCAAGTTAAACTCGAGTTTAACTTGCTCAGTCATCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317959    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_001002929.3-1247s21c1
Sequence:CCGGCCAGTCACACAATCTCTATTTCTCGAGAAATAGAGATTGTGTGACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126742    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_001002929.2-492s1c1
Sequence:CCGGCCTGTGTGAGATTCTCTTTATCTCGAGATAAAGAGAATCTCACACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126740    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_001002929.2-232s1c1
Sequence:CCGGGTGGATGTTTACTCTCAAATTCTCGAGAATTTGAGAGTAAACATCCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126741    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_001002929.2-1212s1c1
Sequence:CCGGCCAGTCACACAATCTCTATTTCTCGAGAAATAGAGATTGTGTGACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126739    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_001002929.2-2025s1c1
Sequence:CCGGGAAGATGAGGACAGTTGCAATCTCGAGATTGCAACTGTCCTCATCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126743    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002929.2-93s1c1
Sequence:CCGGAGGTGTGAATTCCAAGAAGAACTCGAGTTCTTCTTGGAATTCACACCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)