EMAIL THIS PAGE TO A FRIEND

NUP88

nucleoporin 88kDa

54 Gene Product Result for
UniProtKB ID: Q99567, D3DTM2, Q9BWE5
Gene ID:
Human(4927) Summary: The nuclear pore complex is a massive structure that extends across the nuclear envelope, forming a gateway that regulates the flow of macromolecules between the nucleus and the cytoplasm. Nucleoporins, a family of 50 to 100 proteins, are the main components of the nuclear pore complex in eukaryotic cells. The protein encoded by this gene belongs to the nucleoporin family and is associated with the oncogenic nucleoporin CAN/Nup214 in a dynamic subcomplex. This protein is also overexpressed in a large number of malignant neoplasms and precancerous dysplasias. [provided by RefSeq, Jul 2008]
Mouse(19069) nucleoporin 88
Rat(113929) nucleoporin 88
sheep(101107032) nucleoporin 88kDa
naked mole-rat(101726684) nucleoporin 88kDa
domestic guinea pig(100725365) nucleoporin 88kDa
Zebrafish(321744) nucleoporin 88
cow(504786) nucleoporin 88kDa
Horse(100061117) nucleoporin 88kDa
domestic cat(101090055) nucleoporin 88kDa
dog(607268) nucleoporin 88kDa
chicken(417501) nucleoporin 88kDa
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002532 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002532 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002532 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_172394 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172394 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172394 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002532 Rosetta Predictions human pricing
NM_053616 Rosetta Predictions rat pricing
NM_001083331 Rosetta Predictions mouse pricing
NM_172394 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002532 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00115929 predicted 1917
2 SASI_Hs01_00115930 predicted 851
3 SASI_Hs01_00115931 predicted 910
4 SASI_Hs01_00115932 predicted 2041
5 SASI_Hs01_00115933 predicted 380
6 SASI_Hs01_00115934 predicted 1774
7 SASI_Hs01_00115935 predicted 2025
8 SASI_Hs01_00115937 predicted 1192
9 SASI_Hs01_00115938 predicted 588
10 SASI_Hs02_00334013 predicted 378
11 SASI_Hs01_00115936 predicted 1987
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053616 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00036070 predicted 1918
2 SASI_Rn01_00036071 predicted 573
3 SASI_Rn02_00266320 predicted 1861
4 SASI_Rn01_00036072 predicted 1600
5 SASI_Rn01_00036073 predicted 317
6 SASI_Rn01_00036075 predicted 949
7 SASI_Rn01_00036076 predicted 373
8 SASI_Rn01_00036077 predicted 1193
9 SASI_Rn01_00036078 predicted 310
10 SASI_Rn01_00036079 predicted 1775
11 SASI_Rn01_00036074 predicted 1111
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001083331 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00299671 predicted 469
2 SASI_Mm02_00299672 predicted 392
3 SASI_Mm02_00299673 predicted 852
4 SASI_Mm02_00299674 predicted 949
5 SASI_Mm02_00299675 predicted 1287
6 SASI_Mm02_00299676 predicted 1103
7 SASI_Mm02_00299677 predicted 1315
8 SASI_Mm02_00299678 predicted 927
9 SASI_Mm02_00299679 predicted 1264
10 SASI_Mm02_00299680 predicted 304
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172394 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00182941 predicted 478
2 SASI_Mm01_00182942 predicted 401
3 SASI_Mm02_00343840 predicted 865
4 SASI_Mm01_00182943 predicted 961
5 SASI_Mm01_00182944 predicted 1299
6 SASI_Mm01_00182946 predicted 1115
7 SASI_Mm02_00343841 predicted 1323
8 SASI_Mm01_00182949 predicted 941
9 SASI_Mm01_00182950 predicted 1276
10 SASI_Mm02_00343842 predicted 324
11 SASI_Mm01_00182945 predicted 960
12 SASI_Mm01_00182947 predicted 1593
13 SASI_Mm01_00182948 predicted 1660
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002532
VALIDATED
NUP88 MISSION shRNA Bacterial Glycerol Stock
nucleoporin 88kDa
Human
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000141481    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002532.3-987s1c1
Sequence:CCGGCCCAATATCTTAGTGATCGCTCTCGAGAGCGATCACTAAGATATTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139972    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002532.3-552s1c1
Sequence:CCGGGCTGCATGGTATCCAAGTGAACTCGAGTTCACTTGGATACCATGCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323127    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002532.3-928s21c1
Sequence:CCGGCTGCGGCTGAAGATAACTATGCTCGAGCATAGTTATCTTCAGCCGCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141654    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002532.3-931s1c1
Sequence:CCGGCGGCTGAAGATAACTATGGTTCTCGAGAACCATAGTTATCTTCAGCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323242    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002532.3-643s21c1
Sequence:CCGGAGACACCCACTAACGTGATAACTCGAGTTATCACGTTAGTGGGTGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323128    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002532.3-1783s21c1
Sequence:CCGGAGATTCAGCGGAGGGTCAAATCTCGAGATTTGACCCTCCGCTGAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139863    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002532.3-249s1c1
Sequence:CCGGGACAGCTCCTTCTTAGTCGTTCTCGAGAACGACTAAGAAGGAGCTGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350807    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002532.3-1884s21c1
Sequence:CCGGGAGCGTTTAGCTGACAAATATCTCGAGATATTTGTCAGCTAAACGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140312    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002532.3-192s1c1
Sequence:CCGGCTGACGAGAAACGTGGTCTTTCTCGAGAAAGACCACGTTTCTCGTCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140656    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002532.3-927s1c1
Sequence:CCGGCCTGCGGCTGAAGATAACTATCTCGAGATAGTTATCTTCAGCCGCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142385    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002532.3-2187s1c1
Sequence:CCGGGAGGGTGAACATATAAGGGAACTCGAGTTCCCTTATATGTTCACCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142510    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002532.3-799s1c1
Sequence:CCGGGCAAAGATGAAGTAGTGGCATCTCGAGATGCCACTACTTCATCTTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145079    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002532.3-1836s1c1
Sequence:CCGGGATCTCAGTTATTGTCGAGAACTCGAGTTCTCGACAATAACTGAGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145530    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002532.3-382s1c1
Sequence:CCGGCACAACATCATGTAGCACTTACTCGAGTAAGTGCTACATGATGTTGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323129    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002532.3-2030s21c1
Sequence:CCGGACCTGATCAACTTCGACATTTCTCGAGAAATGTCGAAGTTGATCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002532
VALIDATED
NUP88 MISSION shRNA shRNA Plasmid DNA
nucleoporin 88kDa
Human
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000141481    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002532.3-987s1c1
Sequence:CCGGCCCAATATCTTAGTGATCGCTCTCGAGAGCGATCACTAAGATATTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139972    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002532.3-552s1c1
Sequence:CCGGGCTGCATGGTATCCAAGTGAACTCGAGTTCACTTGGATACCATGCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000323127    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002532.3-928s21c1
Sequence:CCGGCTGCGGCTGAAGATAACTATGCTCGAGCATAGTTATCTTCAGCCGCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141654    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002532.3-931s1c1
Sequence:CCGGCGGCTGAAGATAACTATGGTTCTCGAGAACCATAGTTATCTTCAGCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000323242    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002532.3-643s21c1
Sequence:CCGGAGACACCCACTAACGTGATAACTCGAGTTATCACGTTAGTGGGTGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000323128    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002532.3-1783s21c1
Sequence:CCGGAGATTCAGCGGAGGGTCAAATCTCGAGATTTGACCCTCCGCTGAATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139863    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002532.3-249s1c1
Sequence:CCGGGACAGCTCCTTCTTAGTCGTTCTCGAGAACGACTAAGAAGGAGCTGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000350807    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002532.3-1884s21c1
Sequence:CCGGGAGCGTTTAGCTGACAAATATCTCGAGATATTTGTCAGCTAAACGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140312    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002532.3-192s1c1
Sequence:CCGGCTGACGAGAAACGTGGTCTTTCTCGAGAAAGACCACGTTTCTCGTCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140656    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002532.3-927s1c1
Sequence:CCGGCCTGCGGCTGAAGATAACTATCTCGAGATAGTTATCTTCAGCCGCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142385    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002532.3-2187s1c1
Sequence:CCGGGAGGGTGAACATATAAGGGAACTCGAGTTCCCTTATATGTTCACCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142510    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002532.3-799s1c1
Sequence:CCGGGCAAAGATGAAGTAGTGGCATCTCGAGATGCCACTACTTCATCTTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000145079    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002532.3-1836s1c1
Sequence:CCGGGATCTCAGTTATTGTCGAGAACTCGAGTTCTCGACAATAACTGAGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000145530    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002532.3-382s1c1
Sequence:CCGGCACAACATCATGTAGCACTTACTCGAGTAAGTGCTACATGATGTTGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000323129    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002532.3-2030s21c1
Sequence:CCGGACCTGATCAACTTCGACATTTCTCGAGAAATGTCGAAGTTGATCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002532
VALIDATED
NUP88 MISSION shRNA Lentiviral Transduction Particles
nucleoporin 88kDa
Human
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000141481    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002532.3-987s1c1
Sequence:CCGGCCCAATATCTTAGTGATCGCTCTCGAGAGCGATCACTAAGATATTGGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139972    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002532.3-552s1c1
Sequence:CCGGGCTGCATGGTATCCAAGTGAACTCGAGTTCACTTGGATACCATGCAGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000323127    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002532.3-928s21c1
Sequence:CCGGCTGCGGCTGAAGATAACTATGCTCGAGCATAGTTATCTTCAGCCGCAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141654    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002532.3-931s1c1
Sequence:CCGGCGGCTGAAGATAACTATGGTTCTCGAGAACCATAGTTATCTTCAGCCGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000323242    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002532.3-643s21c1
Sequence:CCGGAGACACCCACTAACGTGATAACTCGAGTTATCACGTTAGTGGGTGTCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000323128    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002532.3-1783s21c1
Sequence:CCGGAGATTCAGCGGAGGGTCAAATCTCGAGATTTGACCCTCCGCTGAATCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139863    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002532.3-249s1c1
Sequence:CCGGGACAGCTCCTTCTTAGTCGTTCTCGAGAACGACTAAGAAGGAGCTGTCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000350807    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002532.3-1884s21c1
Sequence:CCGGGAGCGTTTAGCTGACAAATATCTCGAGATATTTGTCAGCTAAACGCTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140312    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002532.3-192s1c1
Sequence:CCGGCTGACGAGAAACGTGGTCTTTCTCGAGAAAGACCACGTTTCTCGTCAGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140656    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002532.3-927s1c1
Sequence:CCGGCCTGCGGCTGAAGATAACTATCTCGAGATAGTTATCTTCAGCCGCAGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142385    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002532.3-2187s1c1
Sequence:CCGGGAGGGTGAACATATAAGGGAACTCGAGTTCCCTTATATGTTCACCCTCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142510    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002532.3-799s1c1
Sequence:CCGGGCAAAGATGAAGTAGTGGCATCTCGAGATGCCACTACTTCATCTTTGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000145079    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002532.3-1836s1c1
Sequence:CCGGGATCTCAGTTATTGTCGAGAACTCGAGTTCTCGACAATAACTGAGATCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000145530    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002532.3-382s1c1
Sequence:CCGGCACAACATCATGTAGCACTTACTCGAGTAAGTGCTACATGATGTTGTGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000323129    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002532.3-2030s21c1
Sequence:CCGGACCTGATCAACTTCGACATTTCTCGAGAAATGTCGAAGTTGATCAGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172394
VALIDATED
NUP88 MISSION shRNA Bacterial Glycerol Stock
nucleoporin 88kDa
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000055321    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_172394.1-1593s1c1
Sequence:CCGGGACTCCTTTGAGAAGCATATTCTCGAGAATATGCTTCTCAAAGGAGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055318    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_172394.1-373s1c1
Sequence:CCGGCCCAACATCATGTAGCACTTACTCGAGTAAGTGCTACATGATGTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055320    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172394.1-639s1c1
Sequence:CCGGCCCACTAAGGTGATTGTACTTCTCGAGAAGTACAATCACCTTAGTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055322    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172394.1-336s1c1
Sequence:CCGGCCCTTGTTTGAAATCCATCAACTCGAGTTGATGGATTTCAAACAAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055319    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172394.1-1188s1c1
Sequence:CCGGCCAATTAAACTGCACAGAGATCTCGAGATCTCTGTGCAGTTTAATTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317203    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_172394.2-1604s21c1
Sequence:CCGGGACTCCTTTGAGAAGCATATTCTCGAGAATATGCTTCTCAAAGGAGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313627    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172394.2-395s21c1
Sequence:CCGGGTAGCACTTATCGGAAGTAAACTCGAGTTTACTTCCGATAAGTGCTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313630    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_172394.2-2267s21c1
Sequence:CCGGACATAACTTGAAGGCTGTAAACTCGAGTTTACAGCCTTCAAGTTATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317202    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_172394.2-347s21c1
Sequence:CCGGCCCTTGTTTGAAATCCATCAACTCGAGTTGATGGATTTCAAACAAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000349919    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_172394.2-1783s21c1
Sequence:CCGGGATTCAGCGGAGGGTCAAATTCTCGAGAATTTGACCCTCCGCTGAATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172394
VALIDATED
NUP88 MISSION shRNA shRNA Plasmid DNA
nucleoporin 88kDa
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000055321    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_172394.1-1593s1c1
Sequence:CCGGGACTCCTTTGAGAAGCATATTCTCGAGAATATGCTTCTCAAAGGAGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055318    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_172394.1-373s1c1
Sequence:CCGGCCCAACATCATGTAGCACTTACTCGAGTAAGTGCTACATGATGTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055320    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172394.1-639s1c1
Sequence:CCGGCCCACTAAGGTGATTGTACTTCTCGAGAAGTACAATCACCTTAGTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055322    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172394.1-336s1c1
Sequence:CCGGCCCTTGTTTGAAATCCATCAACTCGAGTTGATGGATTTCAAACAAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055319    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172394.1-1188s1c1
Sequence:CCGGCCAATTAAACTGCACAGAGATCTCGAGATCTCTGTGCAGTTTAATTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000317203    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_172394.2-1604s21c1
Sequence:CCGGGACTCCTTTGAGAAGCATATTCTCGAGAATATGCTTCTCAAAGGAGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000313627    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172394.2-395s21c1
Sequence:CCGGGTAGCACTTATCGGAAGTAAACTCGAGTTTACTTCCGATAAGTGCTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000313630    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_172394.2-2267s21c1
Sequence:CCGGACATAACTTGAAGGCTGTAAACTCGAGTTTACAGCCTTCAAGTTATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000317202    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_172394.2-347s21c1
Sequence:CCGGCCCTTGTTTGAAATCCATCAACTCGAGTTGATGGATTTCAAACAAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000349919    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_172394.2-1783s21c1
Sequence:CCGGGATTCAGCGGAGGGTCAAATTCTCGAGAATTTGACCCTCCGCTGAATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172394
VALIDATED
NUP88 MISSION shRNA Lentiviral Transduction Particles
nucleoporin 88kDa
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000055321    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_172394.1-1593s1c1
Sequence:CCGGGACTCCTTTGAGAAGCATATTCTCGAGAATATGCTTCTCAAAGGAGTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055318    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_172394.1-373s1c1
Sequence:CCGGCCCAACATCATGTAGCACTTACTCGAGTAAGTGCTACATGATGTTGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055320    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172394.1-639s1c1
Sequence:CCGGCCCACTAAGGTGATTGTACTTCTCGAGAAGTACAATCACCTTAGTGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055322    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172394.1-336s1c1
Sequence:CCGGCCCTTGTTTGAAATCCATCAACTCGAGTTGATGGATTTCAAACAAGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055319    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172394.1-1188s1c1
Sequence:CCGGCCAATTAAACTGCACAGAGATCTCGAGATCTCTGTGCAGTTTAATTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000317203    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_172394.2-1604s21c1
Sequence:CCGGGACTCCTTTGAGAAGCATATTCTCGAGAATATGCTTCTCAAAGGAGTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000313627    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172394.2-395s21c1
Sequence:CCGGGTAGCACTTATCGGAAGTAAACTCGAGTTTACTTCCGATAAGTGCTACTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000313630    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_172394.2-2267s21c1
Sequence:CCGGACATAACTTGAAGGCTGTAAACTCGAGTTTACAGCCTTCAAGTTATGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000317202    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_172394.2-347s21c1
Sequence:CCGGCCCTTGTTTGAAATCCATCAACTCGAGTTGATGGATTTCAAACAAGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000349919    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_172394.2-1783s21c1
Sequence:CCGGGATTCAGCGGAGGGTCAAATTCTCGAGAATTTGACCCTCCGCTGAATCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)