EMAIL THIS PAGE TO A FRIEND

NUP93

nucleoporin 93kDa

65 Gene Product Result for
Synonyms: NIC96
UniProtKB ID: Q8N1F7, B3KPQ8, Q14705
Gene ID:
Mouse(71805) nucleoporin 93
Rat(291874) nucleoporin 93
Zebrafish(30172) nucleoporin 93
cow(510004) nucleoporin 93kDa
domestic cat(101081850) nucleoporin 93kDa
chicken(415693) nucleoporin 93kDa
dog(478119) nucleoporin 93kDa
domestic guinea pig(100726949) nucleoporin 93kDa
naked mole-rat(101707074) nucleoporin 93kDa
sheep(101120350) nucleoporin 93kDa
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_172410 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172410 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172410 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_014669 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014669 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014669 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014669 Rosetta Predictions human pricing
NM_001011925 Rosetta Predictions rat pricing
XM_574200 Rosetta Predictions rat pricing
NM_172410 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014669 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00044130 predicted 1264
2 SASI_Hs01_00044132 predicted 1761
3 SASI_Hs01_00044133 predicted 479
4 SASI_Hs01_00044134 predicted 1182
5 SASI_Hs01_00044136 predicted 2123
6 SASI_Hs01_00044137 predicted 2135
7 SASI_Hs01_00044138 predicted 513
8 SASI_Hs01_00044139 predicted 1784
9 SASI_Hs02_00346017 predicted 808
10 SASI_Hs02_00346018 predicted 1786
11 SASI_Hs01_00044131 predicted 1243
12 SASI_Hs01_00044135 predicted 1172
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001011925 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00079311 predicted 1033
2 SASI_Rn01_00079314 predicted 460
3 SASI_Rn01_00079315 predicted 851
4 SASI_Rn01_00079317 predicted 446
5 SASI_Rn01_00079318 predicted 545
6 SASI_Rn02_00199925 predicted 1881
7 SASI_Rn02_00199926 predicted 1829
8 SASI_Rn01_00079319 predicted 564
9 SASI_Rn01_00079320 predicted 1824
10 SASI_Rn02_00199927 predicted 2061
11 SASI_Rn01_00079312 predicted 740
12 SASI_Rn01_00079313 predicted 2143
13 SASI_Rn01_00079316 predicted 2113
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_574200 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00185586 predicted 836
2 SASI_Rn01_00185587 predicted 1603
3 SASI_Rn01_00185588 predicted 1941
4 SASI_Rn01_00185589 predicted 651
5 SASI_Rn01_00185590 predicted 2034
6 SASI_Rn01_00185591 predicted 1908
7 SASI_Rn01_00185592 predicted 1629
8 SASI_Rn01_00185593 predicted 1976
9 SASI_Rn01_00185594 predicted 957
10 SASI_Rn01_00185595 predicted 1050
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172410 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00153438 predicted 754
2 SASI_Mm01_00153439 predicted 1874
3 SASI_Mm01_00153440 predicted 568
4 SASI_Mm02_00343881 predicted 869
5 SASI_Mm01_00153441 predicted 1898
6 SASI_Mm01_00153442 predicted 2192
7 SASI_Mm01_00153443 predicted 1047
8 SASI_Mm01_00153444 predicted 482
9 SASI_Mm01_00153446 predicted 2210
10 SASI_Mm01_00153447 predicted 1269
11 SASI_Mm01_00153445 predicted 422
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172410
VALIDATED
NUP93 MISSION shRNA Bacterial Glycerol Stock
nucleoporin 93kDa
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000313016    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_172410.2-1284s21c1
Sequence:CCGGGATGCGATATCACCGACAATCCTCGAGGATTGTCGGTGATATCGCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312016    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_172410.2-2583s21c1
Sequence:CCGGCTGCACACTGTCAGTATATTACTCGAGTAATATACTGACAGTGTGCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311944    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_172410.2-2123s21c1
Sequence:CCGGGCTCAGGGAATAAGTGCAAATCTCGAGATTTGCACTTATTCCCTGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311943    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_172410.2-1829s21c1
Sequence:CCGGCGAGAGTTTGATATGATTCTTCTCGAGAAGAATCATATCAAACTCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312971    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_172410.2-176s21c1
Sequence:CCGGCCACATGTAGAACGAAATTTACTCGAGTAAATTTCGTTCTACATGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125224    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_172410.1-2584s1c1
Sequence:CCGGCTGCACACTGTCAGTATATTACTCGAGTAATATACTGACAGTGTGCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125228    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172410.1-264s1c1
Sequence:CCGGGCAGATGTCAAGGCATCAGTTCTCGAGAACTGATGCCTTGACATCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125225    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_172410.1-1830s1c1
Sequence:CCGGCGAGAGTTTGATATGATTCTTCTCGAGAAGAATCATATCAAACTCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125226    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_172410.1-978s1c1
Sequence:CCGGCGGAGTTTCCTAAACATTAAACTCGAGTTTAATGTTTAGGAAACTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125227    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_172410.1-2124s1c1
Sequence:CCGGGCTCAGGGAATAAGTGCAAATCTCGAGATTTGCACTTATTCCCTGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172410
VALIDATED
NUP93 MISSION shRNA shRNA Plasmid DNA
nucleoporin 93kDa
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000313016    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_172410.2-1284s21c1
Sequence:CCGGGATGCGATATCACCGACAATCCTCGAGGATTGTCGGTGATATCGCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000312016    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_172410.2-2583s21c1
Sequence:CCGGCTGCACACTGTCAGTATATTACTCGAGTAATATACTGACAGTGTGCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000311944    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_172410.2-2123s21c1
Sequence:CCGGGCTCAGGGAATAAGTGCAAATCTCGAGATTTGCACTTATTCCCTGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000311943    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_172410.2-1829s21c1
Sequence:CCGGCGAGAGTTTGATATGATTCTTCTCGAGAAGAATCATATCAAACTCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000312971    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_172410.2-176s21c1
Sequence:CCGGCCACATGTAGAACGAAATTTACTCGAGTAAATTTCGTTCTACATGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000125224    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_172410.1-2584s1c1
Sequence:CCGGCTGCACACTGTCAGTATATTACTCGAGTAATATACTGACAGTGTGCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000125228    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172410.1-264s1c1
Sequence:CCGGGCAGATGTCAAGGCATCAGTTCTCGAGAACTGATGCCTTGACATCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000125225    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_172410.1-1830s1c1
Sequence:CCGGCGAGAGTTTGATATGATTCTTCTCGAGAAGAATCATATCAAACTCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000125226    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_172410.1-978s1c1
Sequence:CCGGCGGAGTTTCCTAAACATTAAACTCGAGTTTAATGTTTAGGAAACTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000125227    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_172410.1-2124s1c1
Sequence:CCGGGCTCAGGGAATAAGTGCAAATCTCGAGATTTGCACTTATTCCCTGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172410
VALIDATED
NUP93 MISSION shRNA Lentiviral Transduction Particles
nucleoporin 93kDa
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000313016    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_172410.2-1284s21c1
Sequence:CCGGGATGCGATATCACCGACAATCCTCGAGGATTGTCGGTGATATCGCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312016    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_172410.2-2583s21c1
Sequence:CCGGCTGCACACTGTCAGTATATTACTCGAGTAATATACTGACAGTGTGCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311944    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_172410.2-2123s21c1
Sequence:CCGGGCTCAGGGAATAAGTGCAAATCTCGAGATTTGCACTTATTCCCTGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311943    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_172410.2-1829s21c1
Sequence:CCGGCGAGAGTTTGATATGATTCTTCTCGAGAAGAATCATATCAAACTCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312971    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_172410.2-176s21c1
Sequence:CCGGCCACATGTAGAACGAAATTTACTCGAGTAAATTTCGTTCTACATGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125224    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_172410.1-2584s1c1
Sequence:CCGGCTGCACACTGTCAGTATATTACTCGAGTAATATACTGACAGTGTGCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125228    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172410.1-264s1c1
Sequence:CCGGGCAGATGTCAAGGCATCAGTTCTCGAGAACTGATGCCTTGACATCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125225    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_172410.1-1830s1c1
Sequence:CCGGCGAGAGTTTGATATGATTCTTCTCGAGAAGAATCATATCAAACTCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125226    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_172410.1-978s1c1
Sequence:CCGGCGGAGTTTCCTAAACATTAAACTCGAGTTTAATGTTTAGGAAACTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125227    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_172410.1-2124s1c1
Sequence:CCGGGCTCAGGGAATAAGTGCAAATCTCGAGATTTGCACTTATTCCCTGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014669
VALIDATED
NUP93 MISSION shRNA Bacterial Glycerol Stock
nucleoporin 93kDa
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000311727    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014669.3-1118s21c1
Sequence:CCGGGCCGCTTCACAGGTAGTTAATCTCGAGATTAACTACCTGTGAAGCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311655    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014669.3-899s21c1
Sequence:CCGGGCGTACCTTGAGCAGAGTTATCTCGAGATAACTCTGCTCAAGGTACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311656    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014669.3-1904s21c1
Sequence:CCGGCCTGGAGTCATAGATAAGTTTCTCGAGAAACTTATCTATGACTCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311729    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014669.3-2147s21c1
Sequence:CCGGGCTCAAGGAATAAGCGCAAATCTCGAGATTTGCGCTTATTCCTTGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059958    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014669.2-809s1c1
Sequence:CCGGGCGTACCTTGAGCAGAGTTATCTCGAGATAACTCTGCTCAAGGTACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059961    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_014669.2-2057s1c1
Sequence:CCGGGCTCAAGGAATAAGCGCAAATCTCGAGATTTGCGCTTATTCCTTGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059962    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_014669.2-1028s1c1
Sequence:CCGGGCCGCTTCACAGGTAGTTAATCTCGAGATTAACTACCTGTGAAGCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059960    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014669.2-588s1c1
Sequence:CCGGCGCGGCAAATTTATATCTATACTCGAGTATAGATATAAATTTGCCGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059959    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_014669.2-1814s1c1
Sequence:CCGGCCTGGAGTCATAGATAAGTTTCTCGAGAAACTTATCTATGACTCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014669
VALIDATED
NUP93 MISSION shRNA shRNA Plasmid DNA
nucleoporin 93kDa
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000311727    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014669.3-1118s21c1
Sequence:CCGGGCCGCTTCACAGGTAGTTAATCTCGAGATTAACTACCTGTGAAGCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000311655    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014669.3-899s21c1
Sequence:CCGGGCGTACCTTGAGCAGAGTTATCTCGAGATAACTCTGCTCAAGGTACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000311656    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014669.3-1904s21c1
Sequence:CCGGCCTGGAGTCATAGATAAGTTTCTCGAGAAACTTATCTATGACTCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000311729    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014669.3-2147s21c1
Sequence:CCGGGCTCAAGGAATAAGCGCAAATCTCGAGATTTGCGCTTATTCCTTGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059958    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014669.2-809s1c1
Sequence:CCGGGCGTACCTTGAGCAGAGTTATCTCGAGATAACTCTGCTCAAGGTACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059961    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_014669.2-2057s1c1
Sequence:CCGGGCTCAAGGAATAAGCGCAAATCTCGAGATTTGCGCTTATTCCTTGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059962    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_014669.2-1028s1c1
Sequence:CCGGGCCGCTTCACAGGTAGTTAATCTCGAGATTAACTACCTGTGAAGCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059960    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014669.2-588s1c1
Sequence:CCGGCGCGGCAAATTTATATCTATACTCGAGTATAGATATAAATTTGCCGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059959    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_014669.2-1814s1c1
Sequence:CCGGCCTGGAGTCATAGATAAGTTTCTCGAGAAACTTATCTATGACTCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014669
VALIDATED
NUP93 MISSION shRNA Lentiviral Transduction Particles
nucleoporin 93kDa
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000311727    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014669.3-1118s21c1
Sequence:CCGGGCCGCTTCACAGGTAGTTAATCTCGAGATTAACTACCTGTGAAGCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311655    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014669.3-899s21c1
Sequence:CCGGGCGTACCTTGAGCAGAGTTATCTCGAGATAACTCTGCTCAAGGTACGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311656    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014669.3-1904s21c1
Sequence:CCGGCCTGGAGTCATAGATAAGTTTCTCGAGAAACTTATCTATGACTCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311729    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014669.3-2147s21c1
Sequence:CCGGGCTCAAGGAATAAGCGCAAATCTCGAGATTTGCGCTTATTCCTTGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059958    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014669.2-809s1c1
Sequence:CCGGGCGTACCTTGAGCAGAGTTATCTCGAGATAACTCTGCTCAAGGTACGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059961    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_014669.2-2057s1c1
Sequence:CCGGGCTCAAGGAATAAGCGCAAATCTCGAGATTTGCGCTTATTCCTTGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059962    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_014669.2-1028s1c1
Sequence:CCGGGCCGCTTCACAGGTAGTTAATCTCGAGATTAACTACCTGTGAAGCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059960    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014669.2-588s1c1
Sequence:CCGGCGCGGCAAATTTATATCTATACTCGAGTATAGATATAAATTTGCCGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059959    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_014669.2-1814s1c1
Sequence:CCGGCCTGGAGTCATAGATAAGTTTCTCGAGAAACTTATCTATGACTCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)