EMAIL THIS PAGE TO A FRIEND

NUP98

nucleoporin 98kDa

188 Gene Product Result for
Synonyms: ADIR2 NUP196 NUP96
Gene ID:
Human(4928) Summary: Signal-mediated nuclear import and export proceed through the nuclear pore complex (NPC), which is comprised of approximately 50 unique proteins collectively known as nucleoporins. The 98 kDa nucleoporin is generated through a biogenesis pathway that involves synthesis and proteolytic cleavage of a 186 kDa precursor protein. This cleavage results in the 98 kDa nucleoporin as well as a 96 kDa nucleoporin, both of which are localized to the nucleoplasmic side of the NPC. Rat studies show that the 98 kDa nucleoporin functions as one of several docking site nucleoporins of transport substrates. The human gene has been shown to fuse to several genes following chromosome translocations in acute myelogenous leukemia (AML) and T-cell acute lymphocytic leukemia (T-ALL). This gene is one of several genes located in the imprinted gene domain of 11p15.5, an important tumor-suppressor gene region. Alterations in this region have been associated with the Beckwith-Wiedemann syndrome, Wilms tumor, rhabdomyosarcoma, adrenocortical carcinoma, and lung, ovarian, and breast cancer. Alternative splicing of this gene results in several transcript variants; however, not all variants have been fully described. [provided by RefSeq, May 2010]
Mouse(269966) nucleoporin 98
Rat(81738) nucleoporin 98
sheep(101117360) nucleoporin 98kDa
naked mole-rat(101704068) nucleoporin 98kDa
Domestic Rabbit(100343626) nucleoporin 98kDa
domestic guinea pig(100716227) nucleoporin 98kDa
Zebrafish(777756) nucleoporin 98
cow(540004) nucleoporin 98kDa
Horse(100052986) nucleoporin 98kDa
dog(476822) nucleoporin 98kDa
domestic cat(101086674) nucleoporin 98kDa
chicken(430616) nucleoporin 98kDa
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Cell Lines

Product # Description Species Add to Cart
 
CLL1136 U2OS Cells GFP-NUP98 human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005387 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005387 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005387 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_022979 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_022979 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_022979 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005387 Rosetta Predictions human pricing
NM_016320 Rosetta Predictions human pricing
NM_139131 Rosetta Predictions human pricing
NM_139132 Rosetta Predictions human pricing
XM_001061438 Rosetta Predictions rat pricing
XM_001068584 Rosetta Predictions rat pricing
XM_001068834 Rosetta Predictions rat pricing
XM_574504 Rosetta Predictions rat pricing
NM_022979 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005387 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00025029 predicted 2593
2 SASI_Hs02_00339506 predicted 1910
3 SASI_Hs01_00025031 predicted 2724
4 SASI_Hs01_00025032 predicted 471
5 SASI_Hs01_00025036 predicted 2669
6 SASI_Hs01_00025037 predicted 2334
7 SASI_Hs01_00025038 predicted 2143
8 SASI_Hs02_00339507 predicted 2487
9 SASI_Hs02_00339508 predicted 2427
10 SASI_Hs02_00339509 predicted 2599
11 SASI_Hs01_00025030 predicted 889
12 SASI_Hs01_00025033 predicted 1125
13 SASI_Hs01_00025034 predicted 1024
14 SASI_Hs01_00025035 predicted 847
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016320 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00155429 predicted 2543
2 SASI_Hs02_00349256 predicted 1861
3 SASI_Hs01_00155430 predicted 878
4 SASI_Hs01_00155431 predicted 2672
5 SASI_Hs01_00155433 predicted 1119
6 SASI_Hs01_00155434 predicted 1025
7 SASI_Hs01_00155435 predicted 849
8 SASI_Hs01_00155437 predicted 2289
9 SASI_Hs01_00155438 predicted 2096
10 SASI_Hs02_00349257 predicted 2433
11 SASI_Hs01_00155432 predicted 471
12 SASI_Hs01_00155436 predicted 2626
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_139131 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00108194 predicted 2549
2 SASI_Hs01_00108195 predicted 1866
3 SASI_Hs02_00364142 predicted 876
4 SASI_Hs01_00108196 predicted 2674
5 SASI_Hs02_00364143 predicted 1127
6 SASI_Hs02_00364144 predicted 1020
7 SASI_Hs02_00364145 predicted 842
8 SASI_Hs01_00108200 predicted 2290
9 SASI_Hs01_00108201 predicted 2093
10 SASI_Hs01_00108202 predicted 2436
11 SASI_Hs01_00108193 predicted 552
12 SASI_Hs01_00108197 predicted 471
13 SASI_Hs01_00108198 predicted 2626
14 SASI_Hs01_00108199 predicted 2158
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_139132 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00048500 predicted 2549
2 SASI_Hs02_00364146 predicted 1863
3 SASI_Hs01_00048501 predicted 879
4 SASI_Hs01_00048502 predicted 2677
5 SASI_Hs01_00048504 predicted 1122
6 SASI_Hs01_00048505 predicted 1024
7 SASI_Hs01_00048506 predicted 840
8 SASI_Hs01_00048508 predicted 2286
9 SASI_Hs01_00048509 predicted 2093
10 SASI_Hs02_00364147 predicted 2429
11 SASI_Hs01_00048503 predicted 470
12 SASI_Hs01_00048507 predicted 2630
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001061438 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00300104 predicted 769
2 SASI_Rn02_00300105 predicted 739
3 SASI_Rn02_00300106 predicted 610
4 SASI_Rn02_00300107 predicted 700
5 SASI_Rn02_00300108 predicted 1377
6 SASI_Rn02_00300109 predicted 652
7 SASI_Rn02_00300110 predicted 752
8 SASI_Rn02_00300111 predicted 1540
9 SASI_Rn02_00300112 predicted 2316
10 SASI_Rn02_00300113 predicted 2299
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001068584 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00325050 predicted 3581
2 SASI_Rn02_00325051 predicted 764
3 SASI_Rn02_00325052 predicted 1009
4 SASI_Rn02_00325053 predicted 3691
5 SASI_Rn02_00325054 predicted 1683
6 SASI_Rn02_00325055 predicted 2929
7 SASI_Rn02_00325056 predicted 693
8 SASI_Rn02_00325057 predicted 1107
9 SASI_Rn02_00325058 predicted 3124
10 SASI_Rn02_00325059 predicted 2540
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001068834 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00326058 predicted 3526
2 SASI_Rn02_00326059 predicted 772
3 SASI_Rn02_00326060 predicted 1014
4 SASI_Rn02_00326061 predicted 3633
5 SASI_Rn02_00326062 predicted 4626
6 SASI_Rn02_00326063 predicted 4411
7 SASI_Rn02_00326064 predicted 5206
8 SASI_Rn02_00326065 predicted 4383
9 SASI_Rn02_00326066 predicted 693
10 SASI_Rn02_00326067 predicted 4662
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_574504 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00402101 predicted 840
2 SASI_Rn02_00402102 predicted 773
3 SASI_Rn02_00402103 predicted 2201
4 SASI_Rn02_00402104 predicted 893
5 SASI_Rn02_00402105 predicted 2186
6 SASI_Rn02_00402106 predicted 680
7 SASI_Rn02_00402107 predicted 639
8 SASI_Rn02_00402108 predicted 777
9 SASI_Rn02_00402109 predicted 697
10 SASI_Rn02_00402110 predicted 834
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022979 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00097907 predicted 2749
2 SASI_Mm01_00097908 predicted 1072
3 SASI_Mm01_00097910 predicted 3529
4 SASI_Mm01_00097911 predicted 721
5 SASI_Mm01_00097912 predicted 3079
6 SASI_Mm02_00326696 predicted 3113
7 SASI_Mm01_00097913 predicted 2491
8 SASI_Mm01_00097914 predicted 3644
9 SASI_Mm01_00097915 predicted 3677
10 SASI_Mm02_00326697 predicted 2269
11 SASI_Mm01_00097909 predicted 2522
12 SASI_Mm01_00097916 predicted 2776
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005387
VALIDATED
NUP98 MISSION shRNA Bacterial Glycerol Stock
nucleoporin 98kDa
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000046913    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_005387.3-1634s1c1
Sequence:CCGGGCACATCAATAGTCTAACATACTCGAGTATGTTAGACTATTGATGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046914    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_005387.3-2874s1c1
Sequence:CCGGCCCTTGCAGATGGCTCTTAATCTCGAGATTAAGAGCCATCTGCAAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046916    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_005387.3-731s1c1
Sequence:CCGGGCACCAGTGTATTACTGCTATCTCGAGATAGCAGTAATACACTGGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046917    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005387.3-3702s1c1
Sequence:CCGGCCATTCAAAGTTCACTTAGAACTCGAGTTCTAAGTGAACTTTGAATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046915    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005387.3-5204s1c1
Sequence:CCGGCCTGGACTATATTAGAGTCATCTCGAGATGACTCTAATATAGTCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291178    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005387.4-846s21c1
Sequence:CCGGGCACCAGTGTATTACTGCTATCTCGAGATAGCAGTAATACACTGGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291177    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_005387.4-3040s21c1
Sequence:CCGGCCCTTGCAGATGGCTCTTAATCTCGAGATTAAGAGCCATCTGCAAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296791    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005387.4-3138s21c1
Sequence:CCGGAGCAAGTCATTCAGCTAATACCTCGAGGTATTAGCTGAATGACTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296863    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005387.4-759s21c1
Sequence:CCGGTCCTACTGGGACTACTATTAACTCGAGTTAATAGTAGTCCCAGTAGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000307277    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005387.4-1800s21c1
Sequence:CCGGGCACATCAATAGTCTAACATACTCGAGTATGTTAGACTATTGATGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005387
VALIDATED
NUP98 MISSION shRNA shRNA Plasmid DNA
nucleoporin 98kDa
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000046913    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_005387.3-1634s1c1
Sequence:CCGGGCACATCAATAGTCTAACATACTCGAGTATGTTAGACTATTGATGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046914    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_005387.3-2874s1c1
Sequence:CCGGCCCTTGCAGATGGCTCTTAATCTCGAGATTAAGAGCCATCTGCAAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046916    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_005387.3-731s1c1
Sequence:CCGGGCACCAGTGTATTACTGCTATCTCGAGATAGCAGTAATACACTGGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046917    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005387.3-3702s1c1
Sequence:CCGGCCATTCAAAGTTCACTTAGAACTCGAGTTCTAAGTGAACTTTGAATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046915    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005387.3-5204s1c1
Sequence:CCGGCCTGGACTATATTAGAGTCATCTCGAGATGACTCTAATATAGTCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000291178    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005387.4-846s21c1
Sequence:CCGGGCACCAGTGTATTACTGCTATCTCGAGATAGCAGTAATACACTGGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000291177    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_005387.4-3040s21c1
Sequence:CCGGCCCTTGCAGATGGCTCTTAATCTCGAGATTAAGAGCCATCTGCAAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000296791    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005387.4-3138s21c1
Sequence:CCGGAGCAAGTCATTCAGCTAATACCTCGAGGTATTAGCTGAATGACTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000296863    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005387.4-759s21c1
Sequence:CCGGTCCTACTGGGACTACTATTAACTCGAGTTAATAGTAGTCCCAGTAGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000307277    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005387.4-1800s21c1
Sequence:CCGGGCACATCAATAGTCTAACATACTCGAGTATGTTAGACTATTGATGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005387
VALIDATED
NUP98 MISSION shRNA Lentiviral Transduction Particles
nucleoporin 98kDa
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000046913    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_005387.3-1634s1c1
Sequence:CCGGGCACATCAATAGTCTAACATACTCGAGTATGTTAGACTATTGATGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046914    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_005387.3-2874s1c1
Sequence:CCGGCCCTTGCAGATGGCTCTTAATCTCGAGATTAAGAGCCATCTGCAAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046916    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_005387.3-731s1c1
Sequence:CCGGGCACCAGTGTATTACTGCTATCTCGAGATAGCAGTAATACACTGGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046917    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005387.3-3702s1c1
Sequence:CCGGCCATTCAAAGTTCACTTAGAACTCGAGTTCTAAGTGAACTTTGAATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046915    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005387.3-5204s1c1
Sequence:CCGGCCTGGACTATATTAGAGTCATCTCGAGATGACTCTAATATAGTCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291178    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005387.4-846s21c1
Sequence:CCGGGCACCAGTGTATTACTGCTATCTCGAGATAGCAGTAATACACTGGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291177    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_005387.4-3040s21c1
Sequence:CCGGCCCTTGCAGATGGCTCTTAATCTCGAGATTAAGAGCCATCTGCAAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296791    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005387.4-3138s21c1
Sequence:CCGGAGCAAGTCATTCAGCTAATACCTCGAGGTATTAGCTGAATGACTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296863    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005387.4-759s21c1
Sequence:CCGGTCCTACTGGGACTACTATTAACTCGAGTTAATAGTAGTCCCAGTAGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000307277    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005387.4-1800s21c1
Sequence:CCGGGCACATCAATAGTCTAACATACTCGAGTATGTTAGACTATTGATGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022979
VALIDATED
NUP98 MISSION shRNA Bacterial Glycerol Stock
nucleoporin 98kDa
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000176158    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022979.1-1758s1c1
Sequence:CCGGGCTCTTACAACACCTACTCATCTCGAGATGAGTAGGTGTTGTAAGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174981    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022979.1-1475s1c1
Sequence:CCGGGTTTGGAAACAACCAACCTAACTCGAGTTAGGTTGGTTGTTTCCAAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193881    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_022979.1-1318s1c1
Sequence:CCGGCCCTGACTTTAGGAACCAATACTCGAGTATTGGTTCCTAAAGTCAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193452    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022979.1-2589s1c1
Sequence:CCGGGAAGTTACTTTGGATGGAGTTCTCGAGAACTCCATCCAAAGTAACTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000453126    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022979.1-3806s21c1
Sequence:CCGGTAACCCAAGTATAAGTATTTCCTCGAGGAAATACTTATACTTGGGTTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000446562    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022979.1-387s21c1
Sequence:CCGGGGAACATCAAATAGCTTATTTCTCGAGAAATAAGCTATTTGATGTTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000440795    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022979.1-2441s21c1
Sequence:CCGGAGGATATGGCTCAATCTATTTCTCGAGAAATAGATTGAGCCATATCCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000441431    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022979.1-3742s21c1
Sequence:CCGGGCTGTTCTGTTATCAAGAAACCTCGAGGTTTCTTGATAACAGAACAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000441918    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022979.1-1068s21c1
Sequence:CCGGACCAATACTATGGGCCTATTTCTCGAGAAATAGGCCCATAGTATTGGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000443737    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022979.1-3879s21c1
Sequence:CCGGGTCCTCTGGTAATTATCATACCTCGAGGTATGATAATTACCAGAGGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022979
VALIDATED
NUP98 MISSION shRNA shRNA Plasmid DNA
nucleoporin 98kDa
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000176158    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022979.1-1758s1c1
Sequence:CCGGGCTCTTACAACACCTACTCATCTCGAGATGAGTAGGTGTTGTAAGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000174981    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022979.1-1475s1c1
Sequence:CCGGGTTTGGAAACAACCAACCTAACTCGAGTTAGGTTGGTTGTTTCCAAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000193881    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_022979.1-1318s1c1
Sequence:CCGGCCCTGACTTTAGGAACCAATACTCGAGTATTGGTTCCTAAAGTCAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000193452    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022979.1-2589s1c1
Sequence:CCGGGAAGTTACTTTGGATGGAGTTCTCGAGAACTCCATCCAAAGTAACTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000453126    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022979.1-3806s21c1
Sequence:CCGGTAACCCAAGTATAAGTATTTCCTCGAGGAAATACTTATACTTGGGTTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000446562    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022979.1-387s21c1
Sequence:CCGGGGAACATCAAATAGCTTATTTCTCGAGAAATAAGCTATTTGATGTTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000440795    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022979.1-2441s21c1
Sequence:CCGGAGGATATGGCTCAATCTATTTCTCGAGAAATAGATTGAGCCATATCCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000441431    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022979.1-3742s21c1
Sequence:CCGGGCTGTTCTGTTATCAAGAAACCTCGAGGTTTCTTGATAACAGAACAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000441918    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022979.1-1068s21c1
Sequence:CCGGACCAATACTATGGGCCTATTTCTCGAGAAATAGGCCCATAGTATTGGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000443737    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022979.1-3879s21c1
Sequence:CCGGGTCCTCTGGTAATTATCATACCTCGAGGTATGATAATTACCAGAGGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022979
VALIDATED
NUP98 MISSION shRNA Lentiviral Transduction Particles
nucleoporin 98kDa
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000176158    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022979.1-1758s1c1
Sequence:CCGGGCTCTTACAACACCTACTCATCTCGAGATGAGTAGGTGTTGTAAGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174981    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022979.1-1475s1c1
Sequence:CCGGGTTTGGAAACAACCAACCTAACTCGAGTTAGGTTGGTTGTTTCCAAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193881    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_022979.1-1318s1c1
Sequence:CCGGCCCTGACTTTAGGAACCAATACTCGAGTATTGGTTCCTAAAGTCAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193452    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022979.1-2589s1c1
Sequence:CCGGGAAGTTACTTTGGATGGAGTTCTCGAGAACTCCATCCAAAGTAACTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000453126    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022979.1-3806s21c1
Sequence:CCGGTAACCCAAGTATAAGTATTTCCTCGAGGAAATACTTATACTTGGGTTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000446562    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022979.1-387s21c1
Sequence:CCGGGGAACATCAAATAGCTTATTTCTCGAGAAATAAGCTATTTGATGTTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000440795    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022979.1-2441s21c1
Sequence:CCGGAGGATATGGCTCAATCTATTTCTCGAGAAATAGATTGAGCCATATCCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000441431    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022979.1-3742s21c1
Sequence:CCGGGCTGTTCTGTTATCAAGAAACCTCGAGGTTTCTTGATAACAGAACAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000441918    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022979.1-1068s21c1
Sequence:CCGGACCAATACTATGGGCCTATTTCTCGAGAAATAGGCCCATAGTATTGGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000443737    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022979.1-3879s21c1
Sequence:CCGGGTCCTCTGGTAATTATCATACCTCGAGGTATGATAATTACCAGAGGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)