EMAIL THIS PAGE TO A FRIEND

NUPL2

nucleoporin like 2

58 Gene Product Result for
Synonyms: CG1 NLP-1 NLP_1 hCG1
UniProtKB ID: O15504, A4D143, B4DP42, Q49AE7, Q9BS49
Gene ID:
Mouse(231042) nucleoporin like 2
Rat(499974) nucleoporin like 2
Zebrafish(406491) nucleoporin like 2
domestic cat(101089759) nucleoporin like 2
cow(515127) nucleoporin like 2
dog(611111) nucleoporin like 2
chicken(420614) nucleoporin like 2
sheep(101109696) nucleoporin like 2
naked mole-rat(101699758) nucleoporin like 2
domestic guinea pig(100713358) nucleoporin like 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007342 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_007342 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_007342 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_153092 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_153092 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_153092 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_007342 Rosetta Predictions human pricing
NM_001109217 Rosetta Predictions rat pricing
NM_153092 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007342 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00080315 predicted 712
2 SASI_Hs01_00080316 predicted 797
3 SASI_Hs01_00080317 predicted 931
4 SASI_Hs01_00080318 predicted 505
5 SASI_Hs01_00080319 predicted 1381
6 SASI_Hs01_00080320 predicted 1097
7 SASI_Hs01_00080321 predicted 370
8 SASI_Hs01_00080322 predicted 1385
9 SASI_Hs01_00080323 predicted 1315
10 SASI_Hs02_00343424 predicted 1371
11 SASI_Hs01_00080324 predicted 1220
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109217 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00246240 predicted 610
2 SASI_Rn02_00246241 predicted 990
3 SASI_Rn02_00246242 predicted 971
4 SASI_Rn02_00246243 predicted 706
5 SASI_Rn02_00246244 predicted 560
6 SASI_Rn02_00246245 predicted 571
7 SASI_Rn02_00246246 predicted 544
8 SASI_Rn02_00246247 predicted 637
9 SASI_Rn02_00246248 predicted 1289
10 SASI_Rn02_00246249 predicted 668
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153092 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00089045 predicted 539
2 SASI_Mm01_00089046 predicted 1157
3 SASI_Mm02_00342936 predicted 656
4 SASI_Mm01_00089048 predicted 546
5 SASI_Mm01_00089049 predicted 1361
6 SASI_Mm01_00089050 predicted 1192
7 SASI_Mm01_00089051 predicted 614
8 SASI_Mm01_00089052 predicted 1213
9 SASI_Mm01_00089053 predicted 376
10 SASI_Mm01_00089054 predicted 564
11 SASI_Mm01_00089047 predicted 1294
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007342
VALIDATED
NUPL2 MISSION shRNA Bacterial Glycerol Stock
nucleoporin like 2
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000129199    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_007342.1-1049s1c1
Sequence:CCGGCCAGTTCAGGTATCTCTACTTCTCGAGAAGTAGAGATACCTGAACTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437474    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007342.2-428s21c1
Sequence:CCGGGTCATCCAGCCATCCAGTTTCCTCGAGGAAACTGGATGGCTGGATGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431874    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007342.2-509s21c1
Sequence:CCGGGATTCTGGAGCTTCAACTAACCTCGAGGTTAGTTGAAGCTCCAGAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419844    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007342.2-403s21c1
Sequence:CCGGTACAACTAGCCAGAGATATTCCTCGAGGAATATCTCTGGCTAGTTGTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130430    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007342.1-935s1c1
Sequence:CCGGGCAGTGATAATGCTCAGAACTCTCGAGAGTTCTGAGCATTATCACTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130187    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_007342.1-1465s1c1
Sequence:CCGGCCACCTCTGGAACTTCTAAATCTCGAGATTTAGAAGTTCCAGAGGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128180    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_007342.1-1468s1c1
Sequence:CCGGCCTCTGGAACTTCTAAATGTTCTCGAGAACATTTAGAAGTTCCAGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129028    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_007342.1-1349s1c1
Sequence:CCGGGCAGCATCATTGCAACAGATACTCGAGTATCTGTTGCAATGATGCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435158    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007342.2-1628s21c1
Sequence:CCGGGAATATAAGCTTCCATCAATACTCGAGTATTGATGGAAGCTTATATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430737    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007342.2-748s21c1
Sequence:CCGGTAACTTCTTAACCAGCAATAACTCGAGTTATTGCTGGTTAAGAAGTTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422186    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007342.2-876s21c1
Sequence:CCGGATGTAAAGGATGGAGTAAATCCTCGAGGATTTACTCCATCCTTTACATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007342
VALIDATED
NUPL2 MISSION shRNA shRNA Plasmid DNA
nucleoporin like 2
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000129199    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_007342.1-1049s1c1
Sequence:CCGGCCAGTTCAGGTATCTCTACTTCTCGAGAAGTAGAGATACCTGAACTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000437474    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007342.2-428s21c1
Sequence:CCGGGTCATCCAGCCATCCAGTTTCCTCGAGGAAACTGGATGGCTGGATGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000431874    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007342.2-509s21c1
Sequence:CCGGGATTCTGGAGCTTCAACTAACCTCGAGGTTAGTTGAAGCTCCAGAATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419844    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007342.2-403s21c1
Sequence:CCGGTACAACTAGCCAGAGATATTCCTCGAGGAATATCTCTGGCTAGTTGTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000130430    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007342.1-935s1c1
Sequence:CCGGGCAGTGATAATGCTCAGAACTCTCGAGAGTTCTGAGCATTATCACTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000130187    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_007342.1-1465s1c1
Sequence:CCGGCCACCTCTGGAACTTCTAAATCTCGAGATTTAGAAGTTCCAGAGGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128180    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_007342.1-1468s1c1
Sequence:CCGGCCTCTGGAACTTCTAAATGTTCTCGAGAACATTTAGAAGTTCCAGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129028    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_007342.1-1349s1c1
Sequence:CCGGGCAGCATCATTGCAACAGATACTCGAGTATCTGTTGCAATGATGCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000435158    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007342.2-1628s21c1
Sequence:CCGGGAATATAAGCTTCCATCAATACTCGAGTATTGATGGAAGCTTATATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430737    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007342.2-748s21c1
Sequence:CCGGTAACTTCTTAACCAGCAATAACTCGAGTTATTGCTGGTTAAGAAGTTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422186    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007342.2-876s21c1
Sequence:CCGGATGTAAAGGATGGAGTAAATCCTCGAGGATTTACTCCATCCTTTACATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007342
VALIDATED
NUPL2 MISSION shRNA Lentiviral Transduction Particles
nucleoporin like 2
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000129199    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_007342.1-1049s1c1
Sequence:CCGGCCAGTTCAGGTATCTCTACTTCTCGAGAAGTAGAGATACCTGAACTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437474    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007342.2-428s21c1
Sequence:CCGGGTCATCCAGCCATCCAGTTTCCTCGAGGAAACTGGATGGCTGGATGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431874    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007342.2-509s21c1
Sequence:CCGGGATTCTGGAGCTTCAACTAACCTCGAGGTTAGTTGAAGCTCCAGAATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419844    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007342.2-403s21c1
Sequence:CCGGTACAACTAGCCAGAGATATTCCTCGAGGAATATCTCTGGCTAGTTGTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130430    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007342.1-935s1c1
Sequence:CCGGGCAGTGATAATGCTCAGAACTCTCGAGAGTTCTGAGCATTATCACTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130187    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_007342.1-1465s1c1
Sequence:CCGGCCACCTCTGGAACTTCTAAATCTCGAGATTTAGAAGTTCCAGAGGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128180    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_007342.1-1468s1c1
Sequence:CCGGCCTCTGGAACTTCTAAATGTTCTCGAGAACATTTAGAAGTTCCAGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129028    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_007342.1-1349s1c1
Sequence:CCGGGCAGCATCATTGCAACAGATACTCGAGTATCTGTTGCAATGATGCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435158    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007342.2-1628s21c1
Sequence:CCGGGAATATAAGCTTCCATCAATACTCGAGTATTGATGGAAGCTTATATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430737    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007342.2-748s21c1
Sequence:CCGGTAACTTCTTAACCAGCAATAACTCGAGTTATTGCTGGTTAAGAAGTTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422186    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007342.2-876s21c1
Sequence:CCGGATGTAAAGGATGGAGTAAATCCTCGAGGATTTACTCCATCCTTTACATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153092
NUPL2 MISSION shRNA Bacterial Glycerol Stock
nucleoporin like 2
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000243495    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153092.3-2005s21c1
Sequence:CCGGAGTTGTGAGGCACCATATAAACTCGAGTTTATATGGTGCCTCACAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243492    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153092.3-1358s21c1
Sequence:CCGGTCGAGCTTCTGACTGTATAAACTCGAGTTTATACAGTCAGAAGCTCGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173199    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153092.1-457s1c1
Sequence:CCGGCCAGTGAGAAAGAAACCCAATCTCGAGATTGGGTTTCTTTCTCACTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194170    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153092.1-381s1c1
Sequence:CCGGGAAACTTCTGGAAGGAATTGTCTCGAGACAATTCCTTCCAGAAGTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194646    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153092.1-263s1c1
Sequence:CCGGGAGATCAGGACAAACCACCATCTCGAGATGGTGGTTTGTCCTGATCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241827    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153092.3-585s21c1
Sequence:CCGGGTTGAGGCTTGAATACCATAACTCGAGTTATGGTATTCAAGCCTCAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243493    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153092.3-1203s21c1
Sequence:CCGGGTTTGGAGGTAGCGGCATATCCTCGAGGATATGCCGCTACCTCCAAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243494    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153092.3-621s21c1
Sequence:CCGGTAACTTACAGAGCTATCTAAACTCGAGTTTAGATAGCTCTGTAAGTTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153092
NUPL2 MISSION shRNA shRNA Plasmid DNA
nucleoporin like 2
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000243495    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153092.3-2005s21c1
Sequence:CCGGAGTTGTGAGGCACCATATAAACTCGAGTTTATATGGTGCCTCACAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243492    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153092.3-1358s21c1
Sequence:CCGGTCGAGCTTCTGACTGTATAAACTCGAGTTTATACAGTCAGAAGCTCGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000173199    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153092.1-457s1c1
Sequence:CCGGCCAGTGAGAAAGAAACCCAATCTCGAGATTGGGTTTCTTTCTCACTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194170    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153092.1-381s1c1
Sequence:CCGGGAAACTTCTGGAAGGAATTGTCTCGAGACAATTCCTTCCAGAAGTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194646    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153092.1-263s1c1
Sequence:CCGGGAGATCAGGACAAACCACCATCTCGAGATGGTGGTTTGTCCTGATCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241827    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153092.3-585s21c1
Sequence:CCGGGTTGAGGCTTGAATACCATAACTCGAGTTATGGTATTCAAGCCTCAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243493    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153092.3-1203s21c1
Sequence:CCGGGTTTGGAGGTAGCGGCATATCCTCGAGGATATGCCGCTACCTCCAAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243494    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153092.3-621s21c1
Sequence:CCGGTAACTTACAGAGCTATCTAAACTCGAGTTTAGATAGCTCTGTAAGTTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153092
NUPL2 MISSION shRNA Lentiviral Transduction Particles
nucleoporin like 2
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000243495    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153092.3-2005s21c1
Sequence:CCGGAGTTGTGAGGCACCATATAAACTCGAGTTTATATGGTGCCTCACAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243492    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153092.3-1358s21c1
Sequence:CCGGTCGAGCTTCTGACTGTATAAACTCGAGTTTATACAGTCAGAAGCTCGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173199    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153092.1-457s1c1
Sequence:CCGGCCAGTGAGAAAGAAACCCAATCTCGAGATTGGGTTTCTTTCTCACTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194170    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153092.1-381s1c1
Sequence:CCGGGAAACTTCTGGAAGGAATTGTCTCGAGACAATTCCTTCCAGAAGTTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194646    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153092.1-263s1c1
Sequence:CCGGGAGATCAGGACAAACCACCATCTCGAGATGGTGGTTTGTCCTGATCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241827    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153092.3-585s21c1
Sequence:CCGGGTTGAGGCTTGAATACCATAACTCGAGTTATGGTATTCAAGCCTCAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243493    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153092.3-1203s21c1
Sequence:CCGGGTTTGGAGGTAGCGGCATATCCTCGAGGATATGCCGCTACCTCCAAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243494    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153092.3-621s21c1
Sequence:CCGGTAACTTACAGAGCTATCTAAACTCGAGTTTAGATAGCTCTGTAAGTTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)