EMAIL THIS PAGE TO A FRIEND

NUPR1

nuclear protein, transcriptional regulator, 1

75 Gene Product Result for
Synonyms: COM1 P8
UniProtKB ID: O60356, B2R5C4, O60357, Q6FGG3
Gene ID:
Mouse(56312) nuclear protein transcription regulator 1
Rat(100912108) nuclear protein, transcriptional regulator, 1
domestic guinea pig(100724886) nuclear protein, transcriptional regulator, 1
naked mole-rat(101725080) nuclear protein, transcriptional regulator, 1
sheep(101113556) nuclear protein, transcriptional regulator, 1
Zebrafish(799637) nuclear protein 1
cow(614673) nuclear protein, transcriptional regulator, 1
domestic cat(101089415) nuclear protein, transcriptional regulator, 1
dog(479793) nuclear protein, transcriptional regulator, 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_019738 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019738 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019738 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001042483 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001042483 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001042483 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001042483 Rosetta Predictions human pricing
NM_012385 Rosetta Predictions human pricing
NM_019738 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001042483 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00310098 predicted 687
2 SASI_Hs02_00310099 predicted 681
3 SASI_Hs02_00310100 predicted 629
4 SASI_Hs02_00310101 predicted 335
5 SASI_Hs02_00310102 predicted 880
6 SASI_Hs02_00310103 predicted 328
7 SASI_Hs02_00310104 predicted 378
8 SASI_Hs02_00310105 predicted 404
9 SASI_Hs02_00310106 predicted 558
10 SASI_Hs02_00310107 predicted 721
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012385 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00119350 predicted 627
2 SASI_Hs02_00344187 predicted 627
3 SASI_Hs02_00344188 predicted 582
4 SASI_Hs02_00344189 predicted 334
5 SASI_Hs02_00344190 predicted 823
6 SASI_Hs02_00344191 predicted 330
7 SASI_Hs02_00344192 predicted 505
8 SASI_Hs02_00344193 predicted 673
9 SASI_Hs02_00344194 predicted 711
10 SASI_Hs02_00344195 predicted 342
11 SASI_Hs01_00119347 predicted 375
12 SASI_Hs01_00119348 predicted 387
13 SASI_Hs01_00119349 predicted 219
14 SASI_Hs01_00119351 predicted 226
15 SASI_Hs01_00119352 predicted 378
16 SASI_Hs01_00119353 predicted 227
17 SASI_Hs01_00119354 predicted 367
18 SASI_Hs01_00119355 predicted 285
19 SASI_Hs01_00119356 predicted 215
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019738 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00105962 predicted 283
2 SASI_Mm01_00105963 predicted 230
3 SASI_Mm01_00105964 predicted 385
4 SASI_Mm01_00105965 predicted 223
5 SASI_Mm01_00105966 predicted 300
6 SASI_Mm01_00105967 predicted 229
7 SASI_Mm01_00105968 predicted 234
8 SASI_Mm01_00105969 predicted 310
9 SASI_Mm01_00105970 predicted 384
10 SASI_Mm01_00105971 predicted 325
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019738
VALIDATED
NUPR1 MISSION shRNA Bacterial Glycerol Stock
nuclear protein, transcriptional regulator, 1
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000376676    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019738.1-420s21c1
Sequence:CCGGCTAGGCCTGCTTGATTCTTTCCTCGAGGAAAGAATCAAGCAGGCCTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365921    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019738.1-64s21c1
Sequence:CCGGCCTTCCCAGCAACCTCTAAACCTCGAGGTTTAGAGGTTGCTGGGAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374025    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019738.1-277s21c1
Sequence:CCGGTGAGACGGAGCTGGAGATAAGCTCGAGCTTATCTCCAGCTCCGTCTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000222647    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019738.1-118s1c2
Sequence:CCGGGATCAGTACAGCCTGGCCCATCTCGAGATGGGCCAGGCTGTACTGATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374024    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019738.1-380s21c1
Sequence:CCGGGATACAGGACCTTGGAGAAATCTCGAGATTTCTCCAAGGTCCTGTATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365848    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019738.1-98s21c1
Sequence:CCGGATGGAATCCTGGATGAATATGCTCGAGCATATTCATCCAGGATTCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374023    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019738.1-177s21c1
Sequence:CCGGGAGAGAAGCTGCTGCCAATACCTCGAGGTATTGGCAGCAGCTTCTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077273    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019738.1-428s1c1
Sequence:CCGGGCTTGATTCTTTCCCACCTAACTCGAGTTAGGTGGGAAAGAATCAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077275    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019738.1-239s1c1
Sequence:CCGGCCAAGTTCCAGAACTCTGAAACTCGAGTTTCAGAGTTCTGGAACTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077276    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019738.1-67s1c1
Sequence:CCGGTCCCAGCAACCTCTAAACCTACTCGAGTAGGTTTAGAGGTTGCTGGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077274    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019738.1-76s1c1
Sequence:CCGGCCTCTAAACCTAGAGGATGAACTCGAGTTCATCCTCTAGGTTTAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019738
VALIDATED
NUPR1 MISSION shRNA shRNA Plasmid DNA
nuclear protein, transcriptional regulator, 1
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000376676    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019738.1-420s21c1
Sequence:CCGGCTAGGCCTGCTTGATTCTTTCCTCGAGGAAAGAATCAAGCAGGCCTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000365921    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019738.1-64s21c1
Sequence:CCGGCCTTCCCAGCAACCTCTAAACCTCGAGGTTTAGAGGTTGCTGGGAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000374025    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019738.1-277s21c1
Sequence:CCGGTGAGACGGAGCTGGAGATAAGCTCGAGCTTATCTCCAGCTCCGTCTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000222647    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019738.1-118s1c2
Sequence:CCGGGATCAGTACAGCCTGGCCCATCTCGAGATGGGCCAGGCTGTACTGATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000374024    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019738.1-380s21c1
Sequence:CCGGGATACAGGACCTTGGAGAAATCTCGAGATTTCTCCAAGGTCCTGTATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000365848    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019738.1-98s21c1
Sequence:CCGGATGGAATCCTGGATGAATATGCTCGAGCATATTCATCCAGGATTCCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000374023    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019738.1-177s21c1
Sequence:CCGGGAGAGAAGCTGCTGCCAATACCTCGAGGTATTGGCAGCAGCTTCTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077273    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019738.1-428s1c1
Sequence:CCGGGCTTGATTCTTTCCCACCTAACTCGAGTTAGGTGGGAAAGAATCAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077275    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019738.1-239s1c1
Sequence:CCGGCCAAGTTCCAGAACTCTGAAACTCGAGTTTCAGAGTTCTGGAACTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077276    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019738.1-67s1c1
Sequence:CCGGTCCCAGCAACCTCTAAACCTACTCGAGTAGGTTTAGAGGTTGCTGGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077274    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019738.1-76s1c1
Sequence:CCGGCCTCTAAACCTAGAGGATGAACTCGAGTTCATCCTCTAGGTTTAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019738
VALIDATED
NUPR1 MISSION shRNA Lentiviral Transduction Particles
nuclear protein, transcriptional regulator, 1
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000376676    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019738.1-420s21c1
Sequence:CCGGCTAGGCCTGCTTGATTCTTTCCTCGAGGAAAGAATCAAGCAGGCCTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365921    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019738.1-64s21c1
Sequence:CCGGCCTTCCCAGCAACCTCTAAACCTCGAGGTTTAGAGGTTGCTGGGAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374025    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019738.1-277s21c1
Sequence:CCGGTGAGACGGAGCTGGAGATAAGCTCGAGCTTATCTCCAGCTCCGTCTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000222647    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019738.1-118s1c2
Sequence:CCGGGATCAGTACAGCCTGGCCCATCTCGAGATGGGCCAGGCTGTACTGATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374024    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019738.1-380s21c1
Sequence:CCGGGATACAGGACCTTGGAGAAATCTCGAGATTTCTCCAAGGTCCTGTATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365848    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019738.1-98s21c1
Sequence:CCGGATGGAATCCTGGATGAATATGCTCGAGCATATTCATCCAGGATTCCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374023    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019738.1-177s21c1
Sequence:CCGGGAGAGAAGCTGCTGCCAATACCTCGAGGTATTGGCAGCAGCTTCTCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077273    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019738.1-428s1c1
Sequence:CCGGGCTTGATTCTTTCCCACCTAACTCGAGTTAGGTGGGAAAGAATCAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077275    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019738.1-239s1c1
Sequence:CCGGCCAAGTTCCAGAACTCTGAAACTCGAGTTTCAGAGTTCTGGAACTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077276    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019738.1-67s1c1
Sequence:CCGGTCCCAGCAACCTCTAAACCTACTCGAGTAGGTTTAGAGGTTGCTGGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077274    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019738.1-76s1c1
Sequence:CCGGCCTCTAAACCTAGAGGATGAACTCGAGTTCATCCTCTAGGTTTAGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001042483
VALIDATED
NUPR1 MISSION shRNA Bacterial Glycerol Stock
nuclear protein, transcriptional regulator, 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000263086    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001042483.1-339s21c1
Sequence:CCGGGGATGAATCTGACCTCTATAGCTCGAGCTATAGAGGTCAGATTCATCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263088    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001042483.1-598s21c1
Sequence:CCGGTGGACACTACACCCAGCAATACTCGAGTATTGCTGGGTGTAGTGTCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263085    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001042483.1-411s21c1
Sequence:CCGGTCTGACTCCTGCCTTGGTTACCTCGAGGTAACCAAGGCAGGAGTCAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263087    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042483.1-388s21c1
Sequence:CCGGATCATGCCTATGCCCACTTCACTCGAGTGAAGTGGGCATAGGCATGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000282492    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001042483.1-508s21c1
Sequence:CCGGGAGAGGAAACTGGTGACCAAGCTCGAGCTTGGTCACCAGTTTCCTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001042483
VALIDATED
NUPR1 MISSION shRNA shRNA Plasmid DNA
nuclear protein, transcriptional regulator, 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000263086    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001042483.1-339s21c1
Sequence:CCGGGGATGAATCTGACCTCTATAGCTCGAGCTATAGAGGTCAGATTCATCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000263088    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001042483.1-598s21c1
Sequence:CCGGTGGACACTACACCCAGCAATACTCGAGTATTGCTGGGTGTAGTGTCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000263085    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001042483.1-411s21c1
Sequence:CCGGTCTGACTCCTGCCTTGGTTACCTCGAGGTAACCAAGGCAGGAGTCAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000263087    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042483.1-388s21c1
Sequence:CCGGATCATGCCTATGCCCACTTCACTCGAGTGAAGTGGGCATAGGCATGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000282492    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001042483.1-508s21c1
Sequence:CCGGGAGAGGAAACTGGTGACCAAGCTCGAGCTTGGTCACCAGTTTCCTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001042483
VALIDATED
NUPR1 MISSION shRNA Lentiviral Transduction Particles
nuclear protein, transcriptional regulator, 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000263086    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001042483.1-339s21c1
Sequence:CCGGGGATGAATCTGACCTCTATAGCTCGAGCTATAGAGGTCAGATTCATCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263088    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001042483.1-598s21c1
Sequence:CCGGTGGACACTACACCCAGCAATACTCGAGTATTGCTGGGTGTAGTGTCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263085    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001042483.1-411s21c1
Sequence:CCGGTCTGACTCCTGCCTTGGTTACCTCGAGGTAACCAAGGCAGGAGTCAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263087    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042483.1-388s21c1
Sequence:CCGGATCATGCCTATGCCCACTTCACTCGAGTGAAGTGGGCATAGGCATGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000282492    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001042483.1-508s21c1
Sequence:CCGGGAGAGGAAACTGGTGACCAAGCTCGAGCTTGGTCACCAGTTTCCTCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)