EMAIL THIS PAGE TO A FRIEND

NUS1

nuclear undecaprenyl pyrophosphate synthase 1 homolog (S. cerevisiae)

235 Gene Product Result for
Synonyms: C6orf68 MGC:7199 NgBR TANGO14
UniProtKB ID: Q96E22, B2RWQ4, O00251
Gene ID:
Mouse(52014) nuclear undecaprenyl pyrophosphate synthase 1 homolog (S. cerevisiae)
Rat(294400) nuclear undecaprenyl pyrophosphate synthase 1 homolog (S. cerevisiae)
Zebrafish(436629) nuclear undecaprenyl pyrophosphate synthase 1 homolog (S. cerevisiae)
chicken(421733) nuclear undecaprenyl pyrophosphate synthase 1 homolog (S. cerevisiae)
cow(100849670) nuclear undecaprenyl pyrophosphate synthase 1 homolog (S. cerevisiae)
domestic cat(101094180) nuclear undecaprenyl pyrophosphate synthase 1 homolog (S. cerevisiae)
dog(484102) nuclear undecaprenyl pyrophosphate synthase 1 homolog (S. cerevisiae)
domestic guinea pig(100719005) nuclear undecaprenyl pyrophosphate synthase 1 homolog (S. cerevisiae)
naked mole-rat(101700845) nuclear undecaprenyl pyrophosphate synthase 1 homolog (S. cerevisiae)
sheep(101102568) nuclear undecaprenyl pyrophosphate synthase 1 homolog (S. cerevisiae)
sheep(100135451) nuclear undecaprenyl pyrophosphate synthase 1 homolog (S. cerevisiae)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_138459 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_138459 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_138459 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_030250 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_030250 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_030250 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_138459 Rosetta Predictions human pricing
XM_001058252 Rosetta Predictions rat pricing
XM_215387 Rosetta Predictions rat pricing
NM_030250 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138459 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00216623 predicted 504
2 SASI_Hs01_00216624 predicted 686
3 SASI_Hs01_00216625 predicted 635
4 SASI_Hs01_00216626 predicted 618
5 SASI_Hs01_00216627 predicted 648
6 SASI_Hs01_00216629 predicted 583
7 SASI_Hs01_00216630 predicted 604
8 SASI_Hs01_00216631 predicted 500
9 SASI_Hs01_00216632 predicted 606
10 SASI_Hs02_00363635 predicted 590
11 SASI_Hs01_00216628 predicted 496
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001058252 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00289109 predicted 715
2 SASI_Rn02_00289110 predicted 1010
3 SASI_Rn02_00289111 predicted 1025
4 SASI_Rn02_00289112 predicted 794
5 SASI_Rn02_00289113 predicted 821
6 SASI_Rn02_00289114 predicted 740
7 SASI_Rn02_00289115 predicted 1017
8 SASI_Rn02_00289116 predicted 754
9 SASI_Rn02_00289117 predicted 707
10 SASI_Rn02_00289118 predicted 623
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_215387 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00375935 predicted 711
2 SASI_Rn02_00375936 predicted 1003
3 SASI_Rn02_00375937 predicted 1033
4 SASI_Rn02_00375938 predicted 796
5 SASI_Rn02_00375939 predicted 822
6 SASI_Rn02_00375940 predicted 743
7 SASI_Rn02_00375941 predicted 1020
8 SASI_Rn02_00375942 predicted 750
9 SASI_Rn02_00375943 predicted 703
10 SASI_Rn02_00375944 predicted 626
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030250 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00030657 predicted 564
2 SASI_Mm01_00030658 predicted 813
3 SASI_Mm01_00030659 predicted 762
4 SASI_Mm01_00030660 predicted 871
5 SASI_Mm01_00030661 predicted 661
6 SASI_Mm01_00030662 predicted 595
7 SASI_Mm02_00336717 predicted 642
8 SASI_Mm01_00030663 predicted 461
9 SASI_Mm01_00030664 predicted 589
10 SASI_Mm01_00030665 predicted 860
11 SASI_Mm01_00030666 predicted 696
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138459
NUS1 MISSION shRNA Bacterial Glycerol Stock
nuclear undecaprenyl pyrophosphate synthase 1 homolog (S. cerevisiae)
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000426553    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138459.3-917s21c1
Sequence:CCGGGGTTGTCCTGATCCTGATTTACTCGAGTAAATCAGGATCAGGACAACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419860    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138459.3-1353s21c1
Sequence:CCGGCCTACAACTTTGAGCAAATAGCTCGAGCTATTTGCTCAAAGTTGTAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151043    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138459.2-834s1c1
Sequence:CCGGGATACGTTAGCCAGTTTACTTCTCGAGAAGTAAACTGGCTAACGTATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151210    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_138459.2-1236s1c1
Sequence:CCGGGCACGTTTGTATGTATGGAAACTCGAGTTTCCATACATACAAACGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153268    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138459.2-756s1c1
Sequence:CCGGGCAGATATTGTAAGAGCTGCTCTCGAGAGCAGCTCTTACAATATCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427328    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138459.3-1097s21c1
Sequence:CCGGTAGTGGTCATTGGTTGCATAACTCGAGTTATGCAACCAATGACCACTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155384    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138459.2-1008s1c1
Sequence:CCGGCGTCAATATGCAGCCTGTGAACTCGAGTTCACAGGCTGCATATTGACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150965    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_138459.2-2108s1c1
Sequence:CCGGGCATGGTTAATACCTGAGATTCTCGAGAATCTCAGGTATTAACCATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138459
NUS1 MISSION shRNA shRNA Plasmid DNA
nuclear undecaprenyl pyrophosphate synthase 1 homolog (S. cerevisiae)
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000426553    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138459.3-917s21c1
Sequence:CCGGGGTTGTCCTGATCCTGATTTACTCGAGTAAATCAGGATCAGGACAACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419860    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138459.3-1353s21c1
Sequence:CCGGCCTACAACTTTGAGCAAATAGCTCGAGCTATTTGCTCAAAGTTGTAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151043    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138459.2-834s1c1
Sequence:CCGGGATACGTTAGCCAGTTTACTTCTCGAGAAGTAAACTGGCTAACGTATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151210    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_138459.2-1236s1c1
Sequence:CCGGGCACGTTTGTATGTATGGAAACTCGAGTTTCCATACATACAAACGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153268    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138459.2-756s1c1
Sequence:CCGGGCAGATATTGTAAGAGCTGCTCTCGAGAGCAGCTCTTACAATATCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000427328    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138459.3-1097s21c1
Sequence:CCGGTAGTGGTCATTGGTTGCATAACTCGAGTTATGCAACCAATGACCACTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155384    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138459.2-1008s1c1
Sequence:CCGGCGTCAATATGCAGCCTGTGAACTCGAGTTCACAGGCTGCATATTGACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000150965    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_138459.2-2108s1c1
Sequence:CCGGGCATGGTTAATACCTGAGATTCTCGAGAATCTCAGGTATTAACCATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138459
NUS1 MISSION shRNA Lentiviral Transduction Particles
nuclear undecaprenyl pyrophosphate synthase 1 homolog (S. cerevisiae)
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000426553    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138459.3-917s21c1
Sequence:CCGGGGTTGTCCTGATCCTGATTTACTCGAGTAAATCAGGATCAGGACAACCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419860    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138459.3-1353s21c1
Sequence:CCGGCCTACAACTTTGAGCAAATAGCTCGAGCTATTTGCTCAAAGTTGTAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151043    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138459.2-834s1c1
Sequence:CCGGGATACGTTAGCCAGTTTACTTCTCGAGAAGTAAACTGGCTAACGTATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151210    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_138459.2-1236s1c1
Sequence:CCGGGCACGTTTGTATGTATGGAAACTCGAGTTTCCATACATACAAACGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153268    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138459.2-756s1c1
Sequence:CCGGGCAGATATTGTAAGAGCTGCTCTCGAGAGCAGCTCTTACAATATCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427328    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138459.3-1097s21c1
Sequence:CCGGTAGTGGTCATTGGTTGCATAACTCGAGTTATGCAACCAATGACCACTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155384    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138459.2-1008s1c1
Sequence:CCGGCGTCAATATGCAGCCTGTGAACTCGAGTTCACAGGCTGCATATTGACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150965    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_138459.2-2108s1c1
Sequence:CCGGGCATGGTTAATACCTGAGATTCTCGAGAATCTCAGGTATTAACCATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030250
NUS1 MISSION shRNA Bacterial Glycerol Stock
nuclear undecaprenyl pyrophosphate synthase 1 homolog (S. cerevisiae)
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000246708    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030250.1-691s21c1
Sequence:CCGGTGACAAAGACGATCAAGATTTCTCGAGAAATCTTGATCGTCTTTGTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246710    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030250.1-567s21c1
Sequence:CCGGTCTACGACCACCAAGGTATTTCTCGAGAAATACCTTGGTGGTCGTAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191490    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030250.1-692s1c1
Sequence:CCGGGACAAAGACGATCAAGATTTACTCGAGTAAATCTTGATCGTCTTTGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000202044    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030250.1-929s1c1
Sequence:CCGGCCCTGGCAAATCAGATTGACTCTCGAGAGTCAATCTGATTTGCCAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000202366    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030250.1-836s1c1
Sequence:CCGGGATCTGCTAGGCAGCTTACTTCTCGAGAAGTAAGCTGCCTAGCAGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246707    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030250.1-838s21c1
Sequence:CCGGTCTGCTAGGCAGCTTACTTAGCTCGAGCTAAGTAAGCTGCCTAGCAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246711    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030250.1-899s21c1
Sequence:CCGGGGTCCTGTGGACAGCACATTACTCGAGTAATGTGCTGTCCACAGGACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246709    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030250.1-603s21c1
Sequence:CCGGCCAGATTGATGGATGAAATTTCTCGAGAAATTTCATCCATCAATCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030250
NUS1 MISSION shRNA shRNA Plasmid DNA
nuclear undecaprenyl pyrophosphate synthase 1 homolog (S. cerevisiae)
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000246708    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030250.1-691s21c1
Sequence:CCGGTGACAAAGACGATCAAGATTTCTCGAGAAATCTTGATCGTCTTTGTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000246710    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030250.1-567s21c1
Sequence:CCGGTCTACGACCACCAAGGTATTTCTCGAGAAATACCTTGGTGGTCGTAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000191490    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030250.1-692s1c1
Sequence:CCGGGACAAAGACGATCAAGATTTACTCGAGTAAATCTTGATCGTCTTTGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000202044    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030250.1-929s1c1
Sequence:CCGGCCCTGGCAAATCAGATTGACTCTCGAGAGTCAATCTGATTTGCCAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000202366    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030250.1-836s1c1
Sequence:CCGGGATCTGCTAGGCAGCTTACTTCTCGAGAAGTAAGCTGCCTAGCAGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000246707    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030250.1-838s21c1
Sequence:CCGGTCTGCTAGGCAGCTTACTTAGCTCGAGCTAAGTAAGCTGCCTAGCAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000246711    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030250.1-899s21c1
Sequence:CCGGGGTCCTGTGGACAGCACATTACTCGAGTAATGTGCTGTCCACAGGACCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000246709    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030250.1-603s21c1
Sequence:CCGGCCAGATTGATGGATGAAATTTCTCGAGAAATTTCATCCATCAATCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030250
NUS1 MISSION shRNA Lentiviral Transduction Particles
nuclear undecaprenyl pyrophosphate synthase 1 homolog (S. cerevisiae)
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000246708    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030250.1-691s21c1
Sequence:CCGGTGACAAAGACGATCAAGATTTCTCGAGAAATCTTGATCGTCTTTGTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246710    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030250.1-567s21c1
Sequence:CCGGTCTACGACCACCAAGGTATTTCTCGAGAAATACCTTGGTGGTCGTAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191490    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030250.1-692s1c1
Sequence:CCGGGACAAAGACGATCAAGATTTACTCGAGTAAATCTTGATCGTCTTTGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000202044    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030250.1-929s1c1
Sequence:CCGGCCCTGGCAAATCAGATTGACTCTCGAGAGTCAATCTGATTTGCCAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000202366    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030250.1-836s1c1
Sequence:CCGGGATCTGCTAGGCAGCTTACTTCTCGAGAAGTAAGCTGCCTAGCAGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246707    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030250.1-838s21c1
Sequence:CCGGTCTGCTAGGCAGCTTACTTAGCTCGAGCTAAGTAAGCTGCCTAGCAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246711    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030250.1-899s21c1
Sequence:CCGGGGTCCTGTGGACAGCACATTACTCGAGTAATGTGCTGTCCACAGGACCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246709    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030250.1-603s21c1
Sequence:CCGGCCAGATTGATGGATGAAATTTCTCGAGAAATTTCATCCATCAATCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)