EMAIL THIS PAGE TO A FRIEND

NUTM2A

NUT family member 2A

14 Gene Product Result for
Synonyms: FAM22A
Species: Human NUTM2A(728118)
UniProtKB ID: Q8IVF1, A6NMX5, C9JDI1, Q5VZW1
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001099338 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001099338 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001099338 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001099338 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001099338 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00320509 predicted 2311
2 SASI_Hs02_00320510 predicted 2309
3 SASI_Hs02_00320511 predicted 2459
4 SASI_Hs02_00320512 predicted 603
5 SASI_Hs02_00320513 predicted 1255
6 SASI_Hs02_00320514 predicted 2629
7 SASI_Hs02_00320515 predicted 440
8 SASI_Hs02_00320516 predicted 447
9 SASI_Hs02_00320517 predicted 503
10 SASI_Hs02_00320518 predicted 2788
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001099338
NUTM2A MISSION shRNA Bacterial Glycerol Stock
NUT family member 2A
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000269714    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099338.1-598s21c1
Sequence:CCGGTATGTTCCAGGAACCTGTTTACTCGAGTAAACAGGTTCCTGGAACATATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000269668    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001099338.1-3119s21c1
Sequence:CCGGTCTTGCTGGGCCTTAGCTTTGCTCGAGCAAAGCTAAGGCCCAGCAAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000269666    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099338.1-1136s21c1
Sequence:CCGGTGCTCCTGTGGTGCCTGTTATCTCGAGATAACAGGCACCACAGGAGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000269667    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099338.1-421s21c1
Sequence:CCGGGTGAGTCAGAAGGACAATTTACTCGAGTAAATTGTCCTTCTGACTCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001099338
NUTM2A MISSION shRNA shRNA Plasmid DNA
NUT family member 2A
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000269714    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099338.1-598s21c1
Sequence:CCGGTATGTTCCAGGAACCTGTTTACTCGAGTAAACAGGTTCCTGGAACATATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000269668    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001099338.1-3119s21c1
Sequence:CCGGTCTTGCTGGGCCTTAGCTTTGCTCGAGCAAAGCTAAGGCCCAGCAAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000269666    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099338.1-1136s21c1
Sequence:CCGGTGCTCCTGTGGTGCCTGTTATCTCGAGATAACAGGCACCACAGGAGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000269667    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099338.1-421s21c1
Sequence:CCGGGTGAGTCAGAAGGACAATTTACTCGAGTAAATTGTCCTTCTGACTCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001099338
NUTM2A MISSION shRNA Lentiviral Transduction Particles
NUT family member 2A
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000269714    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099338.1-598s21c1
Sequence:CCGGTATGTTCCAGGAACCTGTTTACTCGAGTAAACAGGTTCCTGGAACATATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000269668    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001099338.1-3119s21c1
Sequence:CCGGTCTTGCTGGGCCTTAGCTTTGCTCGAGCAAAGCTAAGGCCCAGCAAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000269666    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099338.1-1136s21c1
Sequence:CCGGTGCTCCTGTGGTGCCTGTTATCTCGAGATAACAGGCACCACAGGAGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000269667    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099338.1-421s21c1
Sequence:CCGGGTGAGTCAGAAGGACAATTTACTCGAGTAAATTGTCCTTCTGACTCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)