EMAIL THIS PAGE TO A FRIEND

NXNL1

nucleoredoxin-like 1

51 Gene Product Result for
Synonyms: RDCVF TXNL6
UniProtKB ID: Q96CM4
Gene ID:
Mouse(234404) nucleoredoxin-like 1
Rat(306342) nucleoredoxin-like 1
Zebrafish(567911) novel protein similar to vertebrate thioredoxin-like 6 (TXNL6)
chicken(426009) nucleoredoxin-like 1
cow(540608) nucleoredoxin-like 1
domestic cat(101083325) nucleoredoxin-like 1
dog(484836) nucleoredoxin-like 1
naked mole-rat(101715006) nucleoredoxin-like 1
domestic guinea pig(100734414) nucleoredoxin-like 1
sheep(101111362) nucleoredoxin-like 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_138454 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_138454 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_138454 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_145598 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145598 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145598 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU051811 MISSION® esiRNA esiRNA targeting mouse Nxnl1 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_138454 Rosetta Predictions human pricing
NM_001107302 Rosetta Predictions rat pricing
NM_145598 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138454 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00108806 predicted 217
2 SASI_Hs01_00108807 predicted 225
3 SASI_Hs01_00108808 predicted 253
4 SASI_Hs01_00108809 predicted 223
5 SASI_Hs01_00108811 predicted 216
6 SASI_Hs01_00108812 predicted 228
7 SASI_Hs01_00108813 predicted 221
8 SASI_Hs01_00108814 predicted 373
9 SASI_Hs01_00108815 predicted 223
10 SASI_Hs02_00363624 predicted 366
11 SASI_Hs01_00108810 predicted 376
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107302 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00227495 predicted 226
2 SASI_Rn02_00227496 predicted 308
3 SASI_Rn02_00227497 predicted 273
4 SASI_Rn02_00227498 predicted 305
5 SASI_Rn02_00227499 predicted 296
6 SASI_Rn02_00227500 predicted 221
7 SASI_Rn02_00227501 predicted 295
8 SASI_Rn02_00227502 predicted 275
9 SASI_Rn02_00227503 predicted 346
10 SASI_Rn02_00227504 predicted 316
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145598 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00150550 predicted 400
2 SASI_Mm02_00341139 predicted 402
3 SASI_Mm01_00150544 predicted 854
4 SASI_Mm01_00150553 predicted 273
5 SASI_Mm02_00341140 predicted 544
6 SASI_Mm02_00341141 predicted 360
7 SASI_Mm01_00150545 predicted 694
8 SASI_Mm02_00341142 predicted 226
9 SASI_Mm02_00341143 predicted 357
10 SASI_Mm02_00341144 predicted 509
11 SASI_Mm01_00150546 predicted 994
12 SASI_Mm01_00150547 predicted 870
13 SASI_Mm01_00150548 predicted 992
14 SASI_Mm01_00150549 predicted 836
15 SASI_Mm01_00150551 predicted 40
16 SASI_Mm01_00150552 predicted 92
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138454
NXNL1 MISSION shRNA Bacterial Glycerol Stock
nucleoredoxin-like 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000429828    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138454.1-216s21c1
Sequence:CCGGTTCTTCGTGCGGCTCACAGATCTCGAGATCTGTGAGCCGCACGAAGAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425659    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138454.1-304s21c1
Sequence:CCGGAGCAGGACCTGTTCCTCAAGGCTCGAGCCTTGAGGAACAGGTCCTGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421270    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138454.1-712s21c1
Sequence:CCGGGGGTTTGTTGATGAACCTCCACTCGAGTGGAGGTTCATCAACAAACCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424198    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138454.1-350s21c1
Sequence:CCGGGCCCTTTGAGGATGATCTGAGCTCGAGCTCAGATCATCCTCAAAGGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064478    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138454.1-225s1c1
Sequence:CCGGCGGCTCACAGATGAGTTCTATCTCGAGATAGAACTCATCTGTGAGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064479    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138454.1-595s1c1
Sequence:CCGGGCCACAAGTACCGCGTGGAAACTCGAGTTTCCACGCGGTACTTGTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064481    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138454.1-80s1c1
Sequence:CCGGCCGCAACAATAGCGACCAGGACTCGAGTCCTGGTCGCTATTGTTGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064482    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138454.1-313s1c1
Sequence:CCGGTGTTCCTCAAGGACATGCCAACTCGAGTTGGCATGTCCTTGAGGAACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064480    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138454.1-200s1c1
Sequence:CCGGGCCCATCCTCAAGGACTTCTTCTCGAGAAGAAGTCCTTGAGGATGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138454
NXNL1 MISSION shRNA shRNA Plasmid DNA
nucleoredoxin-like 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000429828    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138454.1-216s21c1
Sequence:CCGGTTCTTCGTGCGGCTCACAGATCTCGAGATCTGTGAGCCGCACGAAGAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425659    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138454.1-304s21c1
Sequence:CCGGAGCAGGACCTGTTCCTCAAGGCTCGAGCCTTGAGGAACAGGTCCTGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421270    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138454.1-712s21c1
Sequence:CCGGGGGTTTGTTGATGAACCTCCACTCGAGTGGAGGTTCATCAACAAACCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424198    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138454.1-350s21c1
Sequence:CCGGGCCCTTTGAGGATGATCTGAGCTCGAGCTCAGATCATCCTCAAAGGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064478    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138454.1-225s1c1
Sequence:CCGGCGGCTCACAGATGAGTTCTATCTCGAGATAGAACTCATCTGTGAGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064479    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138454.1-595s1c1
Sequence:CCGGGCCACAAGTACCGCGTGGAAACTCGAGTTTCCACGCGGTACTTGTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064481    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138454.1-80s1c1
Sequence:CCGGCCGCAACAATAGCGACCAGGACTCGAGTCCTGGTCGCTATTGTTGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064482    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138454.1-313s1c1
Sequence:CCGGTGTTCCTCAAGGACATGCCAACTCGAGTTGGCATGTCCTTGAGGAACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064480    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138454.1-200s1c1
Sequence:CCGGGCCCATCCTCAAGGACTTCTTCTCGAGAAGAAGTCCTTGAGGATGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138454
NXNL1 MISSION shRNA Lentiviral Transduction Particles
nucleoredoxin-like 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000429828    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138454.1-216s21c1
Sequence:CCGGTTCTTCGTGCGGCTCACAGATCTCGAGATCTGTGAGCCGCACGAAGAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425659    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138454.1-304s21c1
Sequence:CCGGAGCAGGACCTGTTCCTCAAGGCTCGAGCCTTGAGGAACAGGTCCTGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421270    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138454.1-712s21c1
Sequence:CCGGGGGTTTGTTGATGAACCTCCACTCGAGTGGAGGTTCATCAACAAACCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424198    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138454.1-350s21c1
Sequence:CCGGGCCCTTTGAGGATGATCTGAGCTCGAGCTCAGATCATCCTCAAAGGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064478    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138454.1-225s1c1
Sequence:CCGGCGGCTCACAGATGAGTTCTATCTCGAGATAGAACTCATCTGTGAGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064479    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138454.1-595s1c1
Sequence:CCGGGCCACAAGTACCGCGTGGAAACTCGAGTTTCCACGCGGTACTTGTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064481    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138454.1-80s1c1
Sequence:CCGGCCGCAACAATAGCGACCAGGACTCGAGTCCTGGTCGCTATTGTTGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064482    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138454.1-313s1c1
Sequence:CCGGTGTTCCTCAAGGACATGCCAACTCGAGTTGGCATGTCCTTGAGGAACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064480    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138454.1-200s1c1
Sequence:CCGGGCCCATCCTCAAGGACTTCTTCTCGAGAAGAAGTCCTTGAGGATGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145598
NXNL1 MISSION shRNA Bacterial Glycerol Stock
nucleoredoxin-like 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000114393    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145598.1-109s1c1
Sequence:CCGGGTTAGAGAATCGTCTGGTGTTCTCGAGAACACCAGACGATTCTCTAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114394    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145598.1-359s1c1
Sequence:CCGGCGCCAGTTCTCTGTCCGTCAACTCGAGTTGACGGACAGAGAACTGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114391    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145598.1-1125s1c1
Sequence:CCGGCGCTACATAGAGAGAGCACTACTCGAGTAGTGCTCTCTCTATGTAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114392    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145598.1-175s1c1
Sequence:CCGGCCCAGTCCTCAAAGACTTCTTCTCGAGAAGAAGTCTTTGAGGACTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114395    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145598.1-566s1c1
Sequence:CCGGCGCCGTCGCAAGTACCGAGTACTCGAGTACTCGGTACTTGCGACGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145598
NXNL1 MISSION shRNA shRNA Plasmid DNA
nucleoredoxin-like 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000114393    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145598.1-109s1c1
Sequence:CCGGGTTAGAGAATCGTCTGGTGTTCTCGAGAACACCAGACGATTCTCTAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000114394    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145598.1-359s1c1
Sequence:CCGGCGCCAGTTCTCTGTCCGTCAACTCGAGTTGACGGACAGAGAACTGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000114391    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145598.1-1125s1c1
Sequence:CCGGCGCTACATAGAGAGAGCACTACTCGAGTAGTGCTCTCTCTATGTAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000114392    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145598.1-175s1c1
Sequence:CCGGCCCAGTCCTCAAAGACTTCTTCTCGAGAAGAAGTCTTTGAGGACTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000114395    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145598.1-566s1c1
Sequence:CCGGCGCCGTCGCAAGTACCGAGTACTCGAGTACTCGGTACTTGCGACGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145598
NXNL1 MISSION shRNA Lentiviral Transduction Particles
nucleoredoxin-like 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000114393    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145598.1-109s1c1
Sequence:CCGGGTTAGAGAATCGTCTGGTGTTCTCGAGAACACCAGACGATTCTCTAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114394    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145598.1-359s1c1
Sequence:CCGGCGCCAGTTCTCTGTCCGTCAACTCGAGTTGACGGACAGAGAACTGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114391    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145598.1-1125s1c1
Sequence:CCGGCGCTACATAGAGAGAGCACTACTCGAGTAGTGCTCTCTCTATGTAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114392    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145598.1-175s1c1
Sequence:CCGGCCCAGTCCTCAAAGACTTCTTCTCGAGAAGAAGTCTTTGAGGACTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114395    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145598.1-566s1c1
Sequence:CCGGCGCCGTCGCAAGTACCGAGTACTCGAGTACTCGGTACTTGCGACGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)