EMAIL THIS PAGE TO A FRIEND

NXPH1

neurexophilin 1

156 Gene Product Result for
Synonyms: NPH1
UniProtKB ID: P58417, Q8NB31
Gene ID:
Human(30010) Summary: This gene is a member of the neurexophilin family and encodes a secreted protein with a variable N-terminal domain, a highly conserved, N-glycosylated central domain, a short linker region, and a cysteine-rich C-terminal domain. This protein forms a very tight complex with alpha neurexins, a group of proteins that promote adhesion between dendrites and axons. [provided by RefSeq, Jul 2008]
Mouse(18231) neurexophilin 1
Rat(25501) neurexophilin 1
sheep(101121848) neurexophilin 1
Zebrafish(437006) neurexophilin 1
dog(610361) neurexophilin 1
chicken(420582) neurexophilin 1
cow(614571) neurexophilin 1
domestic cat(101097714) neurexophilin 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152745 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152745 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152745 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008751 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008751 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008751 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU000101 MISSION® esiRNA esiRNA targeting human NXPH1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152745 Rosetta Predictions human pricing
NM_012994 Rosetta Predictions rat pricing
NM_008751 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152745 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00054055 predicted 1533
2 SASI_Hs01_00054056 predicted 1466
3 SASI_Hs02_00366667 predicted 1742
4 SASI_Hs01_00054058 predicted 1111
5 SASI_Hs01_00054059 predicted 1649
6 SASI_Hs01_00054060 predicted 1110
7 SASI_Hs01_00054061 predicted 972
8 SASI_Hs01_00054062 predicted 1662
9 SASI_Hs01_00054063 predicted 1438
10 SASI_Hs01_00054064 predicted 963
11 SASI_Hs01_00054057 predicted 1046
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012994 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00081725 predicted 652
2 SASI_Rn01_00081727 predicted 830
3 SASI_Rn01_00081728 predicted 1292
4 SASI_Rn01_00081729 predicted 960
5 SASI_Rn01_00081730 predicted 1074
6 SASI_Rn01_00081731 predicted 1328
7 SASI_Rn01_00081732 predicted 905
8 SASI_Rn01_00081733 predicted 529
9 SASI_Rn01_00081734 predicted 981
10 SASI_Rn02_00260637 predicted 1015
11 SASI_Rn01_00081726 predicted 1056
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008751 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00033467 predicted 627
2 SASI_Mm01_00033468 predicted 614
3 SASI_Mm01_00033469 predicted 756
4 SASI_Mm01_00033470 predicted 695
5 SASI_Mm01_00033471 predicted 858
6 SASI_Mm01_00033472 predicted 780
7 SASI_Mm01_00033473 predicted 1074
8 SASI_Mm02_00314632 predicted 936
9 SASI_Mm01_00033475 predicted 475
10 SASI_Mm01_00033476 predicted 307
11 SASI_Mm01_00033474 predicted 1177
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152745
NXPH1 MISSION shRNA Bacterial Glycerol Stock
neurexophilin 1
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000164220    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152745.1-1569s1c1
Sequence:CCGGCAGGAGCAAACCCAAAGTCATCTCGAGATGACTTTGGGTTTGCTCCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162398    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152745.1-1381s1c1
Sequence:CCGGCAACTGGTCAAGGGAATGTATCTCGAGATACATTCCCTTGACCAGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163934    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152745.1-975s1c1
Sequence:CCGGGCCAATTTAACGAACGGTGGACTCGAGTCCACCGTTCGTTAAATTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164141    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152745.1-1952s1c1
Sequence:CCGGCCTGAAGACATGCTCTCACATCTCGAGATGTGAGAGCATGTCTTCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162012    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152745.1-1018s1c1
Sequence:CCGGGAAGCAGCAAATCCACACTAACTCGAGTTAGTGTGGATTTGCTGCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161759    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152745.1-976s1c1
Sequence:CCGGCCAATTTAACGAACGGTGGAACTCGAGTTCCACCGTTCGTTAAATTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158594    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152745.1-1754s1c1
Sequence:CCGGCCTGAGGAATTAAAGGTCATACTCGAGTATGACCTTTAATTCCTCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158626    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152745.1-1000s1c1
Sequence:CCGGCAGAACTTCTGAAATCAGGAACTCGAGTTCCTGATTTCAGAAGTTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158978    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152745.1-2040s1c1
Sequence:CCGGGCTTTCATTGTCTGACTCATACTCGAGTATGAGTCAGACAATGAAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159209    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152745.1-1434s1c1
Sequence:CCGGGAATTTGACTTGGCACAACAACTCGAGTTGTTGTGCCAAGTCAAATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161189    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152745.1-1610s1c1
Sequence:CCGGGCCCTTTAAGGTGATCTGTATCTCGAGATACAGATCACCTTAAAGGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161250    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152745.1-1446s1c1
Sequence:CCGGGCACAACAAACCGTGATTGATCTCGAGATCAATCACGGTTTGTTGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161952    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152745.1-1753s1c1
Sequence:CCGGGCCTGAGGAATTAAAGGTCATCTCGAGATGACCTTTAATTCCTCAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152745
NXPH1 MISSION shRNA shRNA Plasmid DNA
neurexophilin 1
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000164220    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152745.1-1569s1c1
Sequence:CCGGCAGGAGCAAACCCAAAGTCATCTCGAGATGACTTTGGGTTTGCTCCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162398    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152745.1-1381s1c1
Sequence:CCGGCAACTGGTCAAGGGAATGTATCTCGAGATACATTCCCTTGACCAGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163934    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152745.1-975s1c1
Sequence:CCGGGCCAATTTAACGAACGGTGGACTCGAGTCCACCGTTCGTTAAATTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000164141    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152745.1-1952s1c1
Sequence:CCGGCCTGAAGACATGCTCTCACATCTCGAGATGTGAGAGCATGTCTTCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162012    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152745.1-1018s1c1
Sequence:CCGGGAAGCAGCAAATCCACACTAACTCGAGTTAGTGTGGATTTGCTGCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161759    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152745.1-976s1c1
Sequence:CCGGCCAATTTAACGAACGGTGGAACTCGAGTTCCACCGTTCGTTAAATTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158594    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152745.1-1754s1c1
Sequence:CCGGCCTGAGGAATTAAAGGTCATACTCGAGTATGACCTTTAATTCCTCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158626    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152745.1-1000s1c1
Sequence:CCGGCAGAACTTCTGAAATCAGGAACTCGAGTTCCTGATTTCAGAAGTTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158978    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152745.1-2040s1c1
Sequence:CCGGGCTTTCATTGTCTGACTCATACTCGAGTATGAGTCAGACAATGAAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159209    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152745.1-1434s1c1
Sequence:CCGGGAATTTGACTTGGCACAACAACTCGAGTTGTTGTGCCAAGTCAAATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161189    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152745.1-1610s1c1
Sequence:CCGGGCCCTTTAAGGTGATCTGTATCTCGAGATACAGATCACCTTAAAGGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161250    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152745.1-1446s1c1
Sequence:CCGGGCACAACAAACCGTGATTGATCTCGAGATCAATCACGGTTTGTTGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161952    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152745.1-1753s1c1
Sequence:CCGGGCCTGAGGAATTAAAGGTCATCTCGAGATGACCTTTAATTCCTCAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152745
NXPH1 MISSION shRNA Lentiviral Transduction Particles
neurexophilin 1
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000164220    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152745.1-1569s1c1
Sequence:CCGGCAGGAGCAAACCCAAAGTCATCTCGAGATGACTTTGGGTTTGCTCCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162398    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152745.1-1381s1c1
Sequence:CCGGCAACTGGTCAAGGGAATGTATCTCGAGATACATTCCCTTGACCAGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163934    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152745.1-975s1c1
Sequence:CCGGGCCAATTTAACGAACGGTGGACTCGAGTCCACCGTTCGTTAAATTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164141    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152745.1-1952s1c1
Sequence:CCGGCCTGAAGACATGCTCTCACATCTCGAGATGTGAGAGCATGTCTTCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162012    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152745.1-1018s1c1
Sequence:CCGGGAAGCAGCAAATCCACACTAACTCGAGTTAGTGTGGATTTGCTGCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161759    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152745.1-976s1c1
Sequence:CCGGCCAATTTAACGAACGGTGGAACTCGAGTTCCACCGTTCGTTAAATTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158594    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152745.1-1754s1c1
Sequence:CCGGCCTGAGGAATTAAAGGTCATACTCGAGTATGACCTTTAATTCCTCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158626    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152745.1-1000s1c1
Sequence:CCGGCAGAACTTCTGAAATCAGGAACTCGAGTTCCTGATTTCAGAAGTTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158978    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152745.1-2040s1c1
Sequence:CCGGGCTTTCATTGTCTGACTCATACTCGAGTATGAGTCAGACAATGAAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159209    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152745.1-1434s1c1
Sequence:CCGGGAATTTGACTTGGCACAACAACTCGAGTTGTTGTGCCAAGTCAAATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161189    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152745.1-1610s1c1
Sequence:CCGGGCCCTTTAAGGTGATCTGTATCTCGAGATACAGATCACCTTAAAGGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161250    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152745.1-1446s1c1
Sequence:CCGGGCACAACAAACCGTGATTGATCTCGAGATCAATCACGGTTTGTTGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161952    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152745.1-1753s1c1
Sequence:CCGGGCCTGAGGAATTAAAGGTCATCTCGAGATGACCTTTAATTCCTCAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008751
NXPH1 MISSION shRNA Bacterial Glycerol Stock
neurexophilin 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000106545    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008751.2-2448s1c1
Sequence:CCGGCGTGTGTAACATGGTGATTTACTCGAGTAAATCACCATGTTACACACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106546    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008751.2-985s1c1
Sequence:CCGGCCGTGATTGATGCTAAAGATTCTCGAGAATCTTTAGCATCAATCACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106549    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008751.2-548s1c1
Sequence:CCGGGAGCAGCAAATCCACGCTAAACTCGAGTTTAGCGTGGATTTGCTGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106548    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008751.2-984s1c1
Sequence:CCGGACCGTGATTGATGCTAAAGATCTCGAGATCTTTAGCATCAATCACGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106547    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008751.2-910s1c1
Sequence:CCGGCCACTGGTCAAGGGAATGTATCTCGAGATACATTCCCTTGACCAGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008751
NXPH1 MISSION shRNA shRNA Plasmid DNA
neurexophilin 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000106545    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008751.2-2448s1c1
Sequence:CCGGCGTGTGTAACATGGTGATTTACTCGAGTAAATCACCATGTTACACACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106546    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008751.2-985s1c1
Sequence:CCGGCCGTGATTGATGCTAAAGATTCTCGAGAATCTTTAGCATCAATCACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106549    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008751.2-548s1c1
Sequence:CCGGGAGCAGCAAATCCACGCTAAACTCGAGTTTAGCGTGGATTTGCTGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106548    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008751.2-984s1c1
Sequence:CCGGACCGTGATTGATGCTAAAGATCTCGAGATCTTTAGCATCAATCACGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106547    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008751.2-910s1c1
Sequence:CCGGCCACTGGTCAAGGGAATGTATCTCGAGATACATTCCCTTGACCAGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008751
NXPH1 MISSION shRNA Lentiviral Transduction Particles
neurexophilin 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000106545    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008751.2-2448s1c1
Sequence:CCGGCGTGTGTAACATGGTGATTTACTCGAGTAAATCACCATGTTACACACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106546    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008751.2-985s1c1
Sequence:CCGGCCGTGATTGATGCTAAAGATTCTCGAGAATCTTTAGCATCAATCACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106549    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008751.2-548s1c1
Sequence:CCGGGAGCAGCAAATCCACGCTAAACTCGAGTTTAGCGTGGATTTGCTGCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106548    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008751.2-984s1c1
Sequence:CCGGACCGTGATTGATGCTAAAGATCTCGAGATCTTTAGCATCAATCACGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106547    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008751.2-910s1c1
Sequence:CCGGCCACTGGTCAAGGGAATGTATCTCGAGATACATTCCCTTGACCAGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)