EMAIL THIS PAGE TO A FRIEND

NXPH4

neurexophilin 4

45 Gene Product Result for
Synonyms: NPH4
UniProtKB ID: O95158, A8K4I4, Q7Z6L3, Q8N462
Gene ID:
Mouse(104080) neurexophilin 4
Rat(59316) neurexophilin 4
naked mole-rat(101722959) neurexophilin 4
sheep(101120405) neurexophilin 4
chicken(100858743) neurexophilin 4
cow(539535) neurexophilin 4
domestic cat(101091029) neurexophilin 4
dog(607393) neurexophilin 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_183297 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_183297 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_183297 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_007224 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_007224 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_007224 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_007224 Rosetta Predictions human pricing
NM_021680 Rosetta Predictions rat pricing
NM_183297 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007224 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00134789 predicted 533
2 SASI_Hs01_00134790 predicted 539
3 SASI_Hs01_00134791 predicted 1185
4 SASI_Hs01_00134792 predicted 1045
5 SASI_Hs01_00134793 predicted 1233
6 SASI_Hs01_00134794 predicted 1172
7 SASI_Hs01_00134795 predicted 1112
8 SASI_Hs01_00134796 predicted 1044
9 SASI_Hs01_00134797 predicted 524
10 SASI_Hs01_00134798 predicted 1114
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021680 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00068839 predicted 879
2 SASI_Rn01_00068840 predicted 1087
3 SASI_Rn01_00068841 predicted 1190
4 SASI_Rn02_00262703 predicted 1125
5 SASI_Rn01_00068844 predicted 289
6 SASI_Rn01_00068845 predicted 1222
7 SASI_Rn01_00068846 predicted 950
8 SASI_Rn02_00262704 predicted 887
9 SASI_Rn01_00068847 predicted 953
10 SASI_Rn01_00068848 predicted 1020
11 SASI_Rn01_00068842 predicted 1083
12 SASI_Rn01_00068843 predicted 981
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_183297 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00081582 predicted 558
2 SASI_Mm01_00081584 predicted 480
3 SASI_Mm01_00081585 predicted 930
4 SASI_Mm01_00081586 predicted 497
5 SASI_Mm01_00081587 predicted 984
6 SASI_Mm02_00350409 predicted 787
7 SASI_Mm02_00350410 predicted 1320
8 SASI_Mm01_00081588 predicted 1181
9 SASI_Mm01_00081589 predicted 534
10 SASI_Mm02_00350411 predicted 517
11 SASI_Mm01_00081581 predicted 1196
12 SASI_Mm01_00081583 predicted 1194
13 SASI_Mm01_00081590 predicted 1060
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_183297
NXPH4 MISSION shRNA Bacterial Glycerol Stock
neurexophilin 4
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000108473    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183297.1-536s1c1
Sequence:CCGGCAGTGTGTACTTCCGTCACAACTCGAGTTGTGACGGAAGTACACACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108471    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183297.1-527s1c1
Sequence:CCGGCGGTACCTTCAGTGTGTACTTCTCGAGAAGTACACACTGAAGGTACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108472    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183297.1-467s1c1
Sequence:CCGGTCGTGTGCATACCCTCAAGTTCTCGAGAACTTGAGGGTATGCACACGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108470    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_183297.1-1191s1c1
Sequence:CCGGGCCCTCTATTTCCTTGTGGTACTCGAGTACCACAAGGAAATAGAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108474    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183297.1-568s1c1
Sequence:CCGGTGGGTAACCTAAGCGTCAGTACTCGAGTACTGACGCTTAGGTTACCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_183297
NXPH4 MISSION shRNA shRNA Plasmid DNA
neurexophilin 4
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000108473    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183297.1-536s1c1
Sequence:CCGGCAGTGTGTACTTCCGTCACAACTCGAGTTGTGACGGAAGTACACACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000108471    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183297.1-527s1c1
Sequence:CCGGCGGTACCTTCAGTGTGTACTTCTCGAGAAGTACACACTGAAGGTACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000108472    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183297.1-467s1c1
Sequence:CCGGTCGTGTGCATACCCTCAAGTTCTCGAGAACTTGAGGGTATGCACACGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000108470    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_183297.1-1191s1c1
Sequence:CCGGGCCCTCTATTTCCTTGTGGTACTCGAGTACCACAAGGAAATAGAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000108474    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183297.1-568s1c1
Sequence:CCGGTGGGTAACCTAAGCGTCAGTACTCGAGTACTGACGCTTAGGTTACCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_183297
NXPH4 MISSION shRNA Lentiviral Transduction Particles
neurexophilin 4
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000108473    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183297.1-536s1c1
Sequence:CCGGCAGTGTGTACTTCCGTCACAACTCGAGTTGTGACGGAAGTACACACTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108471    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183297.1-527s1c1
Sequence:CCGGCGGTACCTTCAGTGTGTACTTCTCGAGAAGTACACACTGAAGGTACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108472    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183297.1-467s1c1
Sequence:CCGGTCGTGTGCATACCCTCAAGTTCTCGAGAACTTGAGGGTATGCACACGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108470    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_183297.1-1191s1c1
Sequence:CCGGGCCCTCTATTTCCTTGTGGTACTCGAGTACCACAAGGAAATAGAGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108474    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183297.1-568s1c1
Sequence:CCGGTGGGTAACCTAAGCGTCAGTACTCGAGTACTGACGCTTAGGTTACCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007224
VALIDATED
NXPH4 MISSION shRNA Bacterial Glycerol Stock
neurexophilin 4
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000155502    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_007224.1-841s1c1
Sequence:CCGGCAAAGAGTCACGCGCTTTCAACTCGAGTTGAAAGCGCGTGACTCTTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155227    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007224.1-562s1c1
Sequence:CCGGGAACGGTACCTTCAGTGTGTACTCGAGTACACACTGAAGGTACCGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153445    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_007224.1-1308s1c1
Sequence:CCGGCCCAAAGTGAAAGGGATAAGACTCGAGTCTTATCCCTTTCACTTTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151537    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_007224.1-994s1c1
Sequence:CCGGCATCTGTATCTTCGTCTCTTTCTCGAGAAAGAGACGAAGATACAGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153661    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007224.1-1052s1c1
Sequence:CCGGCCAGACTATAACTTCCAGAGTCTCGAGACTCTGGAAGTTATAGTCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153767    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_007224.1-1521s1c1
Sequence:CCGGCCTAAGACTGTAAAGGCCTAACTCGAGTTAGGCCTTTACAGTCTTAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154300    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007224.1-982s1c1
Sequence:CCGGGCCCTTCAAAGTCATCTGTATCTCGAGATACAGATGACTTTGAAGGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154100    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_007224.1-868s1c1
Sequence:CCGGCGTGGAGTATGAGAAGACAAACTCGAGTTTGTCTTCTCATACTCCACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000352826    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007224.3-850s21c1
Sequence:CCGGCAAAGAGTCACGCGCTTTCAACTCGAGTTGAAAGCGCGTGACTCTTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219928    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007224.2-495s1c1
Sequence:CCGGACTTCTACTTTCGGGTGCATACTCGAGTATGCACCCGAAAGTAGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219927    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_007224.2-439s1c1
Sequence:CCGGCAAGAGGAAGCCGTCCATCAACTCGAGTTGATGGACGGCTTCCTCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343295    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007224.3-1530s21c1
Sequence:CCGGCCTAAGACTGTAAAGGCCTAACTCGAGTTAGGCCTTTACAGTCTTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343294    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007224.3-1317s21c1
Sequence:CCGGCCCAAAGTGAAAGGGATAAGACTCGAGTCTTATCCCTTTCACTTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000352763    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007224.3-1003s21c1
Sequence:CCGGCATCTGTATCTTCGTCTCTTTCTCGAGAAAGAGACGAAGATACAGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007224
VALIDATED
NXPH4 MISSION shRNA shRNA Plasmid DNA
neurexophilin 4
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000155502    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_007224.1-841s1c1
Sequence:CCGGCAAAGAGTCACGCGCTTTCAACTCGAGTTGAAAGCGCGTGACTCTTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155227    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007224.1-562s1c1
Sequence:CCGGGAACGGTACCTTCAGTGTGTACTCGAGTACACACTGAAGGTACCGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153445    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_007224.1-1308s1c1
Sequence:CCGGCCCAAAGTGAAAGGGATAAGACTCGAGTCTTATCCCTTTCACTTTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151537    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_007224.1-994s1c1
Sequence:CCGGCATCTGTATCTTCGTCTCTTTCTCGAGAAAGAGACGAAGATACAGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153661    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007224.1-1052s1c1
Sequence:CCGGCCAGACTATAACTTCCAGAGTCTCGAGACTCTGGAAGTTATAGTCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153767    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_007224.1-1521s1c1
Sequence:CCGGCCTAAGACTGTAAAGGCCTAACTCGAGTTAGGCCTTTACAGTCTTAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154300    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007224.1-982s1c1
Sequence:CCGGGCCCTTCAAAGTCATCTGTATCTCGAGATACAGATGACTTTGAAGGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154100    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_007224.1-868s1c1
Sequence:CCGGCGTGGAGTATGAGAAGACAAACTCGAGTTTGTCTTCTCATACTCCACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000352826    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007224.3-850s21c1
Sequence:CCGGCAAAGAGTCACGCGCTTTCAACTCGAGTTGAAAGCGCGTGACTCTTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000219928    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007224.2-495s1c1
Sequence:CCGGACTTCTACTTTCGGGTGCATACTCGAGTATGCACCCGAAAGTAGAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000219927    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_007224.2-439s1c1
Sequence:CCGGCAAGAGGAAGCCGTCCATCAACTCGAGTTGATGGACGGCTTCCTCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000343295    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007224.3-1530s21c1
Sequence:CCGGCCTAAGACTGTAAAGGCCTAACTCGAGTTAGGCCTTTACAGTCTTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000343294    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007224.3-1317s21c1
Sequence:CCGGCCCAAAGTGAAAGGGATAAGACTCGAGTCTTATCCCTTTCACTTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000352763    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007224.3-1003s21c1
Sequence:CCGGCATCTGTATCTTCGTCTCTTTCTCGAGAAAGAGACGAAGATACAGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007224
VALIDATED
NXPH4 MISSION shRNA Lentiviral Transduction Particles
neurexophilin 4
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000155502    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_007224.1-841s1c1
Sequence:CCGGCAAAGAGTCACGCGCTTTCAACTCGAGTTGAAAGCGCGTGACTCTTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155227    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007224.1-562s1c1
Sequence:CCGGGAACGGTACCTTCAGTGTGTACTCGAGTACACACTGAAGGTACCGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153445    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_007224.1-1308s1c1
Sequence:CCGGCCCAAAGTGAAAGGGATAAGACTCGAGTCTTATCCCTTTCACTTTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151537    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_007224.1-994s1c1
Sequence:CCGGCATCTGTATCTTCGTCTCTTTCTCGAGAAAGAGACGAAGATACAGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153661    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007224.1-1052s1c1
Sequence:CCGGCCAGACTATAACTTCCAGAGTCTCGAGACTCTGGAAGTTATAGTCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153767    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_007224.1-1521s1c1
Sequence:CCGGCCTAAGACTGTAAAGGCCTAACTCGAGTTAGGCCTTTACAGTCTTAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154300    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007224.1-982s1c1
Sequence:CCGGGCCCTTCAAAGTCATCTGTATCTCGAGATACAGATGACTTTGAAGGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154100    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_007224.1-868s1c1
Sequence:CCGGCGTGGAGTATGAGAAGACAAACTCGAGTTTGTCTTCTCATACTCCACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000352826    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007224.3-850s21c1
Sequence:CCGGCAAAGAGTCACGCGCTTTCAACTCGAGTTGAAAGCGCGTGACTCTTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219928    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007224.2-495s1c1
Sequence:CCGGACTTCTACTTTCGGGTGCATACTCGAGTATGCACCCGAAAGTAGAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219927    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_007224.2-439s1c1
Sequence:CCGGCAAGAGGAAGCCGTCCATCAACTCGAGTTGATGGACGGCTTCCTCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343295    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007224.3-1530s21c1
Sequence:CCGGCCTAAGACTGTAAAGGCCTAACTCGAGTTAGGCCTTTACAGTCTTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343294    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007224.3-1317s21c1
Sequence:CCGGCCCAAAGTGAAAGGGATAAGACTCGAGTCTTATCCCTTTCACTTTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000352763    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007224.3-1003s21c1
Sequence:CCGGCATCTGTATCTTCGTCTCTTTCTCGAGAAAGAGACGAAGATACAGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)