EMAIL THIS PAGE TO A FRIEND

NYAP1

neuronal tyrosine-phosphorylated phosphoinositide-3-kinase adaptor 1

90 Gene Product Result for
Synonyms: C7orf51
UniProtKB ID: Q6ZVC0, Q6U9Y3, Q8N1V0
Gene ID:
Mouse(243300) neuronal tyrosine-phosphorylated phosphoinositide 3-kinase adaptor 1
Rat(304376) neuronal tyrosine-phosphorylated phosphoinositide-3-kinase adaptor 1
domestic cat(101100172) neuronal tyrosine-phosphorylated phosphoinositide-3-kinase adaptor 1
cow(788842) neuronal tyrosine-phosphorylated phosphoinositide-3-kinase adaptor 1
dog(489838) neuronal tyrosine-phosphorylated phosphoinositide-3-kinase adaptor 1
sheep(101121909) neuronal tyrosine-phosphorylated phosphoinositide-3-kinase adaptor 1
naked mole-rat(101718513) neuronal tyrosine-phosphorylated phosphoinositide-3-kinase adaptor 1
domestic guinea pig(100724932) neuronal tyrosine-phosphorylated phosphoinositide-3-kinase adaptor 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA022251 Anti-NYAP1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_175521 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175521 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175521 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_173564 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_173564 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_173564 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU025671 MISSION® esiRNA esiRNA targeting mouse 6430598A04Rik (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_173564 Rosetta Predictions human pricing
NM_001107132 Rosetta Predictions rat pricing
NM_175521 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173564 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00012664 predicted 319
2 SASI_Hs01_00012665 predicted 210
3 SASI_Hs01_00012666 predicted 988
4 SASI_Hs01_00012667 predicted 656
5 SASI_Hs01_00012668 predicted 1105
6 SASI_Hs01_00012669 predicted 1842
7 SASI_Hs02_00368392 predicted 1101
8 SASI_Hs02_00368393 predicted 986
9 SASI_Hs01_00012672 predicted 1761
10 SASI_Hs01_00012673 predicted 2219
11 SASI_Hs01_00012670 predicted 2146
12 SASI_Hs01_00012671 predicted 669
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107132 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00225816 predicted 1402
2 SASI_Rn02_00225817 predicted 2531
3 SASI_Rn02_00225818 predicted 2097
4 SASI_Rn02_00225819 predicted 1208
5 SASI_Rn02_00225820 predicted 1402
6 SASI_Rn02_00225821 predicted 2478
7 SASI_Rn02_00225822 predicted 974
8 SASI_Rn02_00225823 predicted 1412
9 SASI_Rn02_00225824 predicted 2528
10 SASI_Rn02_00225825 predicted 1389
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175521 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00186640 predicted 551
2 SASI_Mm01_00186641 predicted 908
3 SASI_Mm01_00186643 predicted 846
4 SASI_Mm02_00346453 predicted 1135
5 SASI_Mm01_00186644 predicted 2966
6 SASI_Mm01_00186645 predicted 1448
7 SASI_Mm01_00186646 predicted 1037
8 SASI_Mm01_00186647 predicted 894
9 SASI_Mm01_00186648 predicted 1042
10 SASI_Mm01_00186649 predicted 1748
11 SASI_Mm01_00186642 predicted 1749
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175521
NYAP1 MISSION shRNA Bacterial Glycerol Stock
neuronal tyrosine-phosphorylated phosphoinositide-3-kinase adaptor 1
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000110631    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175521.3-1645s1c1
Sequence:CCGGCGTGTCGTACACTATGGTGTACTCGAGTACACCATAGTGTACGACACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110630    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175521.3-3323s1c1
Sequence:CCGGGCCCAGACAGTGACAGTATTTCTCGAGAAATACTGTCACTGTCTGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110632    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175521.3-1039s1c1
Sequence:CCGGTGAGGCTATCTATGAAGAGATCTCGAGATCTCTTCATAGATAGCCTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110633    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175521.3-1656s1c1
Sequence:CCGGCTATGGTGTATTCTGCGGTAACTCGAGTTACCGCAGAATACACCATAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110634    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175521.3-1221s1c1
Sequence:CCGGCCAAGACCACACCTTGTGAAACTCGAGTTTCACAAGGTGTGGTCTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437699    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175521.3-2911s21c1
Sequence:CCGGAGCAGCAGCCCAAGTAATTTGCTCGAGCAAATTACTTGGGCTGCTGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437037    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175521.3-2955s21c1
Sequence:CCGGTGTTGGAAGGAAGGGTCTAAGCTCGAGCTTAGACCCTTCCTTCCAACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175521
NYAP1 MISSION shRNA shRNA Plasmid DNA
neuronal tyrosine-phosphorylated phosphoinositide-3-kinase adaptor 1
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000110631    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175521.3-1645s1c1
Sequence:CCGGCGTGTCGTACACTATGGTGTACTCGAGTACACCATAGTGTACGACACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000110630    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175521.3-3323s1c1
Sequence:CCGGGCCCAGACAGTGACAGTATTTCTCGAGAAATACTGTCACTGTCTGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000110632    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175521.3-1039s1c1
Sequence:CCGGTGAGGCTATCTATGAAGAGATCTCGAGATCTCTTCATAGATAGCCTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000110633    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175521.3-1656s1c1
Sequence:CCGGCTATGGTGTATTCTGCGGTAACTCGAGTTACCGCAGAATACACCATAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000110634    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175521.3-1221s1c1
Sequence:CCGGCCAAGACCACACCTTGTGAAACTCGAGTTTCACAAGGTGTGGTCTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000437699    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175521.3-2911s21c1
Sequence:CCGGAGCAGCAGCCCAAGTAATTTGCTCGAGCAAATTACTTGGGCTGCTGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000437037    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175521.3-2955s21c1
Sequence:CCGGTGTTGGAAGGAAGGGTCTAAGCTCGAGCTTAGACCCTTCCTTCCAACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175521
NYAP1 MISSION shRNA Lentiviral Transduction Particles
neuronal tyrosine-phosphorylated phosphoinositide-3-kinase adaptor 1
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000110631    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175521.3-1645s1c1
Sequence:CCGGCGTGTCGTACACTATGGTGTACTCGAGTACACCATAGTGTACGACACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110630    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175521.3-3323s1c1
Sequence:CCGGGCCCAGACAGTGACAGTATTTCTCGAGAAATACTGTCACTGTCTGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110632    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175521.3-1039s1c1
Sequence:CCGGTGAGGCTATCTATGAAGAGATCTCGAGATCTCTTCATAGATAGCCTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110633    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175521.3-1656s1c1
Sequence:CCGGCTATGGTGTATTCTGCGGTAACTCGAGTTACCGCAGAATACACCATAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110634    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175521.3-1221s1c1
Sequence:CCGGCCAAGACCACACCTTGTGAAACTCGAGTTTCACAAGGTGTGGTCTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437699    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175521.3-2911s21c1
Sequence:CCGGAGCAGCAGCCCAAGTAATTTGCTCGAGCAAATTACTTGGGCTGCTGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437037    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175521.3-2955s21c1
Sequence:CCGGTGTTGGAAGGAAGGGTCTAAGCTCGAGCTTAGACCCTTCCTTCCAACATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173564
NYAP1 MISSION shRNA Bacterial Glycerol Stock
neuronal tyrosine-phosphorylated phosphoinositide-3-kinase adaptor 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000158540    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173564.2-936s1c1
Sequence:CCGGCATCTATGAAGAGATGAAGTACTCGAGTACTTCATCTCTTCATAGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166361    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173564.2-1106s1c1
Sequence:CCGGCCAAGACCACTCCTTGTGAAACTCGAGTTTCACAAGGAGTGGTCTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165832    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173564.2-798s1c1
Sequence:CCGGGCCTGTGTACATTGAGATGGTCTCGAGACCATCTCAATGTACACAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163858    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173564.2-3317s1c1
Sequence:CCGGCCCAAGACCATTCACAGTATTCTCGAGAATACTGTGAATGGTCTTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165164    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173564.2-925s1c1
Sequence:CCGGGAGAGTGAGGCCATCTATGAACTCGAGTTCATAGATGGCCTCACTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165377    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173564.2-922s1c1
Sequence:CCGGGAAGAGAGTGAGGCCATCTATCTCGAGATAGATGGCCTCACTCTCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165898    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173564.2-3316s1c1
Sequence:CCGGGCCCAAGACCATTCACAGTATCTCGAGATACTGTGAATGGTCTTGGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166270    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173564.2-327s1c1
Sequence:CCGGCAGGATGGGTTTCATGACGATCTCGAGATCGTCATGAAACCCATCCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166834    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173564.2-790s1c1
Sequence:CCGGCAGGAAGAGCCTGTGTACATTCTCGAGAATGTACACAGGCTCTTCCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166833    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173564.2-579s1c1
Sequence:CCGGCAAGAAAGCAGGCTCACAGAACTCGAGTTCTGTGAGCCTGCTTTCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173564
NYAP1 MISSION shRNA shRNA Plasmid DNA
neuronal tyrosine-phosphorylated phosphoinositide-3-kinase adaptor 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000158540    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173564.2-936s1c1
Sequence:CCGGCATCTATGAAGAGATGAAGTACTCGAGTACTTCATCTCTTCATAGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000166361    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173564.2-1106s1c1
Sequence:CCGGCCAAGACCACTCCTTGTGAAACTCGAGTTTCACAAGGAGTGGTCTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165832    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173564.2-798s1c1
Sequence:CCGGGCCTGTGTACATTGAGATGGTCTCGAGACCATCTCAATGTACACAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163858    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173564.2-3317s1c1
Sequence:CCGGCCCAAGACCATTCACAGTATTCTCGAGAATACTGTGAATGGTCTTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165164    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173564.2-925s1c1
Sequence:CCGGGAGAGTGAGGCCATCTATGAACTCGAGTTCATAGATGGCCTCACTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165377    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173564.2-922s1c1
Sequence:CCGGGAAGAGAGTGAGGCCATCTATCTCGAGATAGATGGCCTCACTCTCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165898    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173564.2-3316s1c1
Sequence:CCGGGCCCAAGACCATTCACAGTATCTCGAGATACTGTGAATGGTCTTGGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000166270    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173564.2-327s1c1
Sequence:CCGGCAGGATGGGTTTCATGACGATCTCGAGATCGTCATGAAACCCATCCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000166834    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173564.2-790s1c1
Sequence:CCGGCAGGAAGAGCCTGTGTACATTCTCGAGAATGTACACAGGCTCTTCCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000166833    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173564.2-579s1c1
Sequence:CCGGCAAGAAAGCAGGCTCACAGAACTCGAGTTCTGTGAGCCTGCTTTCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173564
NYAP1 MISSION shRNA Lentiviral Transduction Particles
neuronal tyrosine-phosphorylated phosphoinositide-3-kinase adaptor 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000158540    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173564.2-936s1c1
Sequence:CCGGCATCTATGAAGAGATGAAGTACTCGAGTACTTCATCTCTTCATAGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166361    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173564.2-1106s1c1
Sequence:CCGGCCAAGACCACTCCTTGTGAAACTCGAGTTTCACAAGGAGTGGTCTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165832    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173564.2-798s1c1
Sequence:CCGGGCCTGTGTACATTGAGATGGTCTCGAGACCATCTCAATGTACACAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163858    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173564.2-3317s1c1
Sequence:CCGGCCCAAGACCATTCACAGTATTCTCGAGAATACTGTGAATGGTCTTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165164    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173564.2-925s1c1
Sequence:CCGGGAGAGTGAGGCCATCTATGAACTCGAGTTCATAGATGGCCTCACTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165377    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173564.2-922s1c1
Sequence:CCGGGAAGAGAGTGAGGCCATCTATCTCGAGATAGATGGCCTCACTCTCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165898    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173564.2-3316s1c1
Sequence:CCGGGCCCAAGACCATTCACAGTATCTCGAGATACTGTGAATGGTCTTGGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166270    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173564.2-327s1c1
Sequence:CCGGCAGGATGGGTTTCATGACGATCTCGAGATCGTCATGAAACCCATCCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166834    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173564.2-790s1c1
Sequence:CCGGCAGGAAGAGCCTGTGTACATTCTCGAGAATGTACACAGGCTCTTCCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166833    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173564.2-579s1c1
Sequence:CCGGCAAGAAAGCAGGCTCACAGAACTCGAGTTCTGTGAGCCTGCTTTCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)