EMAIL THIS PAGE TO A FRIEND

NYAP2

neuronal tyrosine-phosphorylated phosphoinositide-3-kinase adaptor 2

192 Gene Product Result for
Synonyms: KIAA1486
UniProtKB ID: Q9P242, A2RRN4, Q96NL2
Gene ID:
Mouse(241134) neuronal tyrosine-phophorylated phosphoinositide 3-kinase adaptor 2
Rat(301561) neuronal tyrosine-phosphorylated phosphoinositide-3-kinase adaptor 2
domestic guinea pig(100717210) neuronal tyrosine-phosphorylated phosphoinositide-3-kinase adaptor 2
sheep(101123610) neuronal tyrosine-phosphorylated phosphoinositide-3-kinase adaptor 2
chicken(424802) neuronal tyrosine-phosphorylated phosphoinositide-3-kinase adaptor 2
cow(615765) neuronal tyrosine-phosphorylated phosphoinositide-3-kinase adaptor 2
domestic cat(101085912) neuronal tyrosine-phosphorylated phosphoinositide-3-kinase adaptor 2
dog(486147) neuronal tyrosine-phosphorylated phosphoinositide-3-kinase adaptor 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_172849 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172849 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172849 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_020864 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020864 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020864 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020864 Rosetta Predictions human pricing
XM_041126 Rosetta Predictions human pricing
XM_934913 Rosetta Predictions human pricing
XM_001063925 Rosetta Predictions rat pricing
XM_237329 Rosetta Predictions rat pricing
NM_172849 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020864 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00354145 predicted 573
2 SASI_Hs02_00354146 predicted 222
3 SASI_Hs02_00354147 predicted 305
4 SASI_Hs02_00354148 predicted 690
5 SASI_Hs02_00354149 predicted 1802
6 SASI_Hs02_00354150 predicted 2105
7 SASI_Hs02_00354151 predicted 1562
8 SASI_Hs02_00354152 predicted 785
9 SASI_Hs02_00354153 predicted 1967
10 SASI_Hs02_00354154 predicted 2193
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_041126 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00278928 predicted 580
2 SASI_Hs01_00278929 predicted 221
3 SASI_Hs01_00278930 predicted 303
4 SASI_Hs01_00278931 predicted 689
5 SASI_Hs01_00278932 predicted 1804
6 SASI_Hs01_00278933 predicted 2104
7 SASI_Hs01_00278934 predicted 1560
8 SASI_Hs01_00278935 predicted 785
9 SASI_Hs01_00278936 predicted 2185
10 SASI_Hs01_00278937 predicted 489
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_934913 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00296567 predicted 446
2 SASI_Hs01_00296568 predicted 1012
3 SASI_Hs01_00296569 predicted 1236
4 SASI_Hs01_00296570 predicted 1084
5 SASI_Hs01_00296571 predicted 1087
6 SASI_Hs01_00296572 predicted 1020
7 SASI_Hs01_00296573 predicted 1097
8 SASI_Hs01_00296574 predicted 1067
9 SASI_Hs01_00296575 predicted 1015
10 SASI_Hs01_00296576 predicted 1032
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001063925 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00308758 predicted 2598
2 SASI_Rn02_00308759 predicted 683
3 SASI_Rn02_00308760 predicted 1456
4 SASI_Rn02_00308761 predicted 1091
5 SASI_Rn02_00308762 predicted 2816
6 SASI_Rn02_00308763 predicted 668
7 SASI_Rn02_00308764 predicted 2554
8 SASI_Rn02_00308765 predicted 1203
9 SASI_Rn02_00308766 predicted 1684
10 SASI_Rn02_00308767 predicted 779
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_237329 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00390827 predicted 2598
2 SASI_Rn02_00390828 predicted 690
3 SASI_Rn02_00390829 predicted 1458
4 SASI_Rn02_00390830 predicted 1084
5 SASI_Rn02_00390831 predicted 2820
6 SASI_Rn02_00390832 predicted 672
7 SASI_Rn02_00390833 predicted 2552
8 SASI_Rn02_00390834 predicted 1195
9 SASI_Rn02_00390835 predicted 1682
10 SASI_Rn02_00390836 predicted 773
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172849 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00127726 predicted 841
2 SASI_Mm01_00127727 predicted 677
3 SASI_Mm01_00127728 predicted 2140
4 SASI_Mm02_00344794 predicted 1547
5 SASI_Mm01_00127729 predicted 602
6 SASI_Mm01_00127730 predicted 1712
7 SASI_Mm01_00127731 predicted 1763
8 SASI_Mm01_00127732 predicted 2220
9 SASI_Mm01_00127733 predicted 1493
10 SASI_Mm01_00127734 predicted 2556
11 SASI_Mm01_00127735 predicted 2378
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172849
NYAP2 MISSION shRNA Bacterial Glycerol Stock
neuronal tyrosine-phosphorylated phosphoinositide-3-kinase adaptor 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000110624    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172849.2-2140s1c1
Sequence:CCGGTGGTCAATGCTGCGGTGAATACTCGAGTATTCACCGCAGCATTGACCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110620    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172849.2-3047s1c1
Sequence:CCGGCGCAATGTAATCCTGCATATTCTCGAGAATATGCAGGATTACATTGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110623    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172849.2-2722s1c1
Sequence:CCGGGCAGCAGTCTACAGTTAGGAACTCGAGTTCCTAACTGTAGACTGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110622    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172849.2-1278s1c1
Sequence:CCGGCGGAATCCTAATACTCAACTTCTCGAGAAGTTGAGTATTAGGATTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110621    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172849.2-1494s1c1
Sequence:CCGGGAGGAGATGAAATATCCCATTCTCGAGAATGGGATATTTCATCTCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172849
NYAP2 MISSION shRNA shRNA Plasmid DNA
neuronal tyrosine-phosphorylated phosphoinositide-3-kinase adaptor 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000110624    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172849.2-2140s1c1
Sequence:CCGGTGGTCAATGCTGCGGTGAATACTCGAGTATTCACCGCAGCATTGACCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000110620    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172849.2-3047s1c1
Sequence:CCGGCGCAATGTAATCCTGCATATTCTCGAGAATATGCAGGATTACATTGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000110623    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172849.2-2722s1c1
Sequence:CCGGGCAGCAGTCTACAGTTAGGAACTCGAGTTCCTAACTGTAGACTGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000110622    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172849.2-1278s1c1
Sequence:CCGGCGGAATCCTAATACTCAACTTCTCGAGAAGTTGAGTATTAGGATTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000110621    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172849.2-1494s1c1
Sequence:CCGGGAGGAGATGAAATATCCCATTCTCGAGAATGGGATATTTCATCTCCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172849
NYAP2 MISSION shRNA Lentiviral Transduction Particles
neuronal tyrosine-phosphorylated phosphoinositide-3-kinase adaptor 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000110624    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172849.2-2140s1c1
Sequence:CCGGTGGTCAATGCTGCGGTGAATACTCGAGTATTCACCGCAGCATTGACCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110620    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172849.2-3047s1c1
Sequence:CCGGCGCAATGTAATCCTGCATATTCTCGAGAATATGCAGGATTACATTGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110623    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172849.2-2722s1c1
Sequence:CCGGGCAGCAGTCTACAGTTAGGAACTCGAGTTCCTAACTGTAGACTGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110622    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172849.2-1278s1c1
Sequence:CCGGCGGAATCCTAATACTCAACTTCTCGAGAAGTTGAGTATTAGGATTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110621    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172849.2-1494s1c1
Sequence:CCGGGAGGAGATGAAATATCCCATTCTCGAGAATGGGATATTTCATCTCCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020864
NYAP2 MISSION shRNA Bacterial Glycerol Stock
neuronal tyrosine-phosphorylated phosphoinositide-3-kinase adaptor 2
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000268454    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020864.1-328s21c1
Sequence:CCGGTGAAACTAACCTAGCCTATTTCTCGAGAAATAGGCTAGGTTAGTTTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000268408    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020864.1-2116s21c1
Sequence:CCGGATCGTTAGCCAATCGTGATTGCTCGAGCAATCACGATTGGCTAACGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264253    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020864.1-1008s21c1
Sequence:CCGGACTTGGGCCAAGACGCCAAATCTCGAGATTTGGCGTCTTGGCCCAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264254    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020864.1-2587s21c1
Sequence:CCGGCTTAGCTCTTATCCTATTATACTCGAGTATAATAGGATAAGAGCTAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264252    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020864.1-689s21c1
Sequence:CCGGAGGACTGAAGCGTCAGCTAAACTCGAGTTTAGCTGACGCTTCAGTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020864
NYAP2 MISSION shRNA shRNA Plasmid DNA
neuronal tyrosine-phosphorylated phosphoinositide-3-kinase adaptor 2
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000268454    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020864.1-328s21c1
Sequence:CCGGTGAAACTAACCTAGCCTATTTCTCGAGAAATAGGCTAGGTTAGTTTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000268408    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020864.1-2116s21c1
Sequence:CCGGATCGTTAGCCAATCGTGATTGCTCGAGCAATCACGATTGGCTAACGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000264253    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020864.1-1008s21c1
Sequence:CCGGACTTGGGCCAAGACGCCAAATCTCGAGATTTGGCGTCTTGGCCCAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000264254    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020864.1-2587s21c1
Sequence:CCGGCTTAGCTCTTATCCTATTATACTCGAGTATAATAGGATAAGAGCTAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000264252    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020864.1-689s21c1
Sequence:CCGGAGGACTGAAGCGTCAGCTAAACTCGAGTTTAGCTGACGCTTCAGTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020864
NYAP2 MISSION shRNA Lentiviral Transduction Particles
neuronal tyrosine-phosphorylated phosphoinositide-3-kinase adaptor 2
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000268454    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020864.1-328s21c1
Sequence:CCGGTGAAACTAACCTAGCCTATTTCTCGAGAAATAGGCTAGGTTAGTTTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000268408    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020864.1-2116s21c1
Sequence:CCGGATCGTTAGCCAATCGTGATTGCTCGAGCAATCACGATTGGCTAACGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264253    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020864.1-1008s21c1
Sequence:CCGGACTTGGGCCAAGACGCCAAATCTCGAGATTTGGCGTCTTGGCCCAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264254    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020864.1-2587s21c1
Sequence:CCGGCTTAGCTCTTATCCTATTATACTCGAGTATAATAGGATAAGAGCTAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264252    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020864.1-689s21c1
Sequence:CCGGAGGACTGAAGCGTCAGCTAAACTCGAGTTTAGCTGACGCTTCAGTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)