EMAIL THIS PAGE TO A FRIEND

NYNRIN

NYN domain and retroviral integrase containing

125 Gene Product Result for
Synonyms: CGIN1 KIAA1305
UniProtKB ID: Q9P2P1, Q6P153, Q86TR3, Q9HAC4
Gene ID:
Mouse(277154) NYN domain and retroviral integrase containing
cow(516993) NYN domain and retroviral integrase containing
domestic cat(101083772) NYN domain and retroviral integrase containing
dog(490625) NYN domain and retroviral integrase containing
naked mole-rat(101717507) NYN domain and retroviral integrase containing
domestic guinea pig(100733900) NYN domain and retroviral integrase containing
sheep(101118362) NYN domain and retroviral integrase containing
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001040072 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001040072 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001040072 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_025081 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_025081 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_025081 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_025081 Rosetta Predictions human pricing
XM_370756 Rosetta Predictions human pricing
XM_001476299 Rosetta Predictions mouse pricing
XM_147850 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025081 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00357767 predicted 1535
2 SASI_Hs02_00357768 predicted 1744
3 SASI_Hs02_00357769 predicted 2518
4 SASI_Hs02_00357770 predicted 2946
5 SASI_Hs02_00357771 predicted 5633
6 SASI_Hs02_00357772 predicted 5001
7 SASI_Hs02_00357773 predicted 1312
8 SASI_Hs02_00357774 predicted 5846
9 SASI_Hs02_00357775 predicted 2440
10 SASI_Hs02_00357776 predicted 2144
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_370756 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00261177 predicted 3033
2 SASI_Hs01_00261178 predicted 1740
3 SASI_Hs01_00261179 predicted 2514
4 SASI_Hs01_00261180 predicted 2951
5 SASI_Hs01_00261181 predicted 5640
6 SASI_Hs01_00261182 predicted 4996
7 SASI_Hs01_00261183 predicted 4578
8 SASI_Hs01_00261184 predicted 1312
9 SASI_Hs01_00261185 predicted 5847
10 SASI_Hs01_00261186 predicted 2443
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001476299 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00388189 predicted 4573
2 SASI_Mm02_00388190 predicted 2313
3 SASI_Mm02_00388191 predicted 1907
4 SASI_Mm02_00388192 predicted 4355
5 SASI_Mm02_00388193 predicted 4991
6 SASI_Mm02_00388194 predicted 5206
7 SASI_Mm02_00388195 predicted 1277
8 SASI_Mm02_00388196 predicted 2325
9 SASI_Mm02_00388197 predicted 451
10 SASI_Mm02_00388198 predicted 4286
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_147850 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00425349 predicted 4805
2 SASI_Mm01_00257675 predicted 2540
3 SASI_Mm02_00425350 predicted 2129
4 SASI_Mm01_00257676 predicted 4590
5 SASI_Mm01_00257677 predicted 5227
6 SASI_Mm01_00257678 predicted 5430
7 SASI_Mm02_00425351 predicted 1510
8 SASI_Mm01_00257680 predicted 2550
9 SASI_Mm01_00257681 predicted 675
10 SASI_Mm01_00257682 predicted 4521
11 SASI_Mm01_00257674 predicted 1314
12 SASI_Mm01_00257679 predicted 3851
13 SASI_Mm01_00257683 predicted 3158
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001040072
NYNRIN MISSION shRNA Bacterial Glycerol Stock
NYN domain and retroviral integrase containing
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000367290    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001040072.1-5899s21c1
Sequence:CCGGGGAGCAAAGGAGTCTCCTTAACTCGAGTTAAGGAGACTCCTTTGCTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000367221    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040072.1-720s21c1
Sequence:CCGGCATTGAGTGGCTCGGCCATTTCTCGAGAAATGGCCGAGCCACTCAATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000367219    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040072.1-4615s21c1
Sequence:CCGGGGGCTAGAGGACACCTATAAGCTCGAGCTTATAGGTGTCCTCTAGCCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000367291    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040072.1-1217s21c1
Sequence:CCGGCCACCTTCTGGAAGATCAATGCTCGAGCATTGATCTTCCAGAAGGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000367218    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040072.1-3246s21c1
Sequence:CCGGGGATTCCCACCGGGATGTTATCTCGAGATAACATCCCGGTGGGAATCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001040072
NYNRIN MISSION shRNA shRNA Plasmid DNA
NYN domain and retroviral integrase containing
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000367290    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001040072.1-5899s21c1
Sequence:CCGGGGAGCAAAGGAGTCTCCTTAACTCGAGTTAAGGAGACTCCTTTGCTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000367221    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040072.1-720s21c1
Sequence:CCGGCATTGAGTGGCTCGGCCATTTCTCGAGAAATGGCCGAGCCACTCAATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000367219    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040072.1-4615s21c1
Sequence:CCGGGGGCTAGAGGACACCTATAAGCTCGAGCTTATAGGTGTCCTCTAGCCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000367291    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040072.1-1217s21c1
Sequence:CCGGCCACCTTCTGGAAGATCAATGCTCGAGCATTGATCTTCCAGAAGGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000367218    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040072.1-3246s21c1
Sequence:CCGGGGATTCCCACCGGGATGTTATCTCGAGATAACATCCCGGTGGGAATCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001040072
NYNRIN MISSION shRNA Lentiviral Transduction Particles
NYN domain and retroviral integrase containing
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000367290    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001040072.1-5899s21c1
Sequence:CCGGGGAGCAAAGGAGTCTCCTTAACTCGAGTTAAGGAGACTCCTTTGCTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000367221    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040072.1-720s21c1
Sequence:CCGGCATTGAGTGGCTCGGCCATTTCTCGAGAAATGGCCGAGCCACTCAATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000367219    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040072.1-4615s21c1
Sequence:CCGGGGGCTAGAGGACACCTATAAGCTCGAGCTTATAGGTGTCCTCTAGCCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000367291    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040072.1-1217s21c1
Sequence:CCGGCCACCTTCTGGAAGATCAATGCTCGAGCATTGATCTTCCAGAAGGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000367218    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040072.1-3246s21c1
Sequence:CCGGGGATTCCCACCGGGATGTTATCTCGAGATAACATCCCGGTGGGAATCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025081
NYNRIN MISSION shRNA Bacterial Glycerol Stock
NYN domain and retroviral integrase containing
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000218378    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025081.2-5210s21c1
Sequence:GTACCGGGCCATAAGCATGTACTTATTGCTCGAGCAATAAGTACATGCTTATGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230518    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025081.2-3264s21c1
Sequence:CCGGCCTGGAGAGTCTGCCGAATATCTCGAGATATTCGGCAGACTCTCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230517    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025081.2-2939s21c1
Sequence:CCGGAGATCACCACCTACGATTATACTCGAGTATAATCGTAGGTGGTGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230520    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025081.2-6272s21c1
Sequence:CCGGGGAGTGCTCCTCTAGGCTATACTCGAGTATAGCCTAGAGGAGCACTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230519    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025081.2-5105s21c1
Sequence:CCGGGCAGCGAGTTGAAGGTTATTGCTCGAGCAATAACCTTCAACTCGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025081
NYNRIN MISSION shRNA shRNA Plasmid DNA
NYN domain and retroviral integrase containing
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000218378    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025081.2-5210s21c1
Sequence:GTACCGGGCCATAAGCATGTACTTATTGCTCGAGCAATAAGTACATGCTTATGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000230518    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025081.2-3264s21c1
Sequence:CCGGCCTGGAGAGTCTGCCGAATATCTCGAGATATTCGGCAGACTCTCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000230517    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025081.2-2939s21c1
Sequence:CCGGAGATCACCACCTACGATTATACTCGAGTATAATCGTAGGTGGTGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000230520    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025081.2-6272s21c1
Sequence:CCGGGGAGTGCTCCTCTAGGCTATACTCGAGTATAGCCTAGAGGAGCACTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000230519    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025081.2-5105s21c1
Sequence:CCGGGCAGCGAGTTGAAGGTTATTGCTCGAGCAATAACCTTCAACTCGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025081
NYNRIN MISSION shRNA Lentiviral Transduction Particles
NYN domain and retroviral integrase containing
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000218378    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025081.2-5210s21c1
Sequence:GTACCGGGCCATAAGCATGTACTTATTGCTCGAGCAATAAGTACATGCTTATGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230518    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025081.2-3264s21c1
Sequence:CCGGCCTGGAGAGTCTGCCGAATATCTCGAGATATTCGGCAGACTCTCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230517    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025081.2-2939s21c1
Sequence:CCGGAGATCACCACCTACGATTATACTCGAGTATAATCGTAGGTGGTGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230520    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025081.2-6272s21c1
Sequence:CCGGGGAGTGCTCCTCTAGGCTATACTCGAGTATAGCCTAGAGGAGCACTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230519    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025081.2-5105s21c1
Sequence:CCGGGCAGCGAGTTGAAGGTTATTGCTCGAGCAATAACCTTCAACTCGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)