EMAIL THIS PAGE TO A FRIEND

NYX

nyctalopin

68 Gene Product Result for
Synonyms: CLRP CSNB1 CSNB1A CSNB4 NBM1
UniProtKB ID: Q9GZU5, D3DWC0, Q2M1S4, Q5H983, Q9H4J0
Gene ID:
Human(60506) Summary: The product of this gene belongs to the small leucine-rich proteoglycan (SLRP) family of proteins. Defects in this gene are the cause of congenital stationary night blindness type 1 (CSNB1), also called X-linked congenital stationary night blindness (XLCSNB). CSNB1 is a rare inherited retinal disorder characterized by impaired scotopic vision, myopia, hyperopia, nystagmus and reduced visual acuity. The role of other SLRP proteins suggests that mutations in this gene disrupt developing retinal interconnections involving the ON-bipolar cells, leading to the visual losses seen in patients with complete CSNB. [provided by RefSeq, Oct 2008]
Mouse(236690) nyctalopin
Rat(302516) nyctalopin
Zebrafish(568821) nyctalopin
cow(101904567) nyctalopin
dog(491837) nyctalopin
chicken(418566) nyctalopin
sheep(101102294) nyctalopin
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1302372 ANTI-NYX (N-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_022567 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022567 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022567 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_173415 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_173415 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_173415 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_022567 Rosetta Predictions human pricing
NM_001100967 Rosetta Predictions rat pricing
NM_173415 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022567 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00059994 predicted 1822
2 SASI_Hs01_00059995 predicted 1225
3 SASI_Hs01_00059997 predicted 458
4 SASI_Hs01_00059998 predicted 936
5 SASI_Hs01_00059999 predicted 652
6 SASI_Hs02_00355860 predicted 1152
7 SASI_Hs01_00060000 predicted 1966
8 SASI_Hs01_00060001 predicted 471
9 SASI_Hs01_00060002 predicted 1571
10 SASI_Hs01_00060003 predicted 1626
11 SASI_Hs01_00059996 predicted 1482
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001100967 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00210812 predicted 1135
2 SASI_Rn02_00210813 predicted 1643
3 SASI_Rn02_00210814 predicted 1013
4 SASI_Rn02_00210815 predicted 1649
5 SASI_Rn02_00210816 predicted 1487
6 SASI_Rn02_00210817 predicted 1025
7 SASI_Rn02_00210818 predicted 1669
8 SASI_Rn02_00210819 predicted 1213
9 SASI_Rn02_00210820 predicted 1693
10 SASI_Rn02_00210821 predicted 1347
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173415 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00105822 predicted 1504
2 SASI_Mm01_00105823 predicted 1691
3 SASI_Mm02_00345282 predicted 1641
4 SASI_Mm01_00105825 predicted 2094
5 SASI_Mm01_00105826 predicted 390
6 SASI_Mm01_00105827 predicted 1743
7 SASI_Mm01_00105828 predicted 1660
8 SASI_Mm01_00105829 predicted 1836
9 SASI_Mm01_00105830 predicted 1207
10 SASI_Mm01_00105831 predicted 1575
11 SASI_Mm01_00105824 predicted 3548
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022567
NYX MISSION shRNA Bacterial Glycerol Stock
nyctalopin
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000446194    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022567.2-2207s21c1
Sequence:CCGGGCCTGCAAGGCCTGAATTAGACTCGAGTCTAATTCAGGCCTTGCAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425244    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022567.2-2283s21c1
Sequence:CCGGCCCATTACACCGAAGTCCTTTCTCGAGAAAGGACTTCGGTGTAATGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083318    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022567.1-2532s1c1
Sequence:CCGGCCTAGCCACAAAGGAACTTTACTCGAGTAAAGTTCCTTTGTGGCTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083320    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022567.1-869s1c1
Sequence:CCGGGCCGCCTAGACCTAGCAGCCTCTCGAGAGGCTGCTAGGTCTAGGCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083321    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022567.1-1828s1c1
Sequence:CCGGCCCTGGTTTCTCCTCGCCTCTCTCGAGAGAGGCGAGGAGAAACCAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083322    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022567.1-1155s1c1
Sequence:CCGGGCATCTGCTGCTCAACGACAACTCGAGTTGTCGTTGAGCAGCAGATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022567
NYX MISSION shRNA shRNA Plasmid DNA
nyctalopin
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000446194    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022567.2-2207s21c1
Sequence:CCGGGCCTGCAAGGCCTGAATTAGACTCGAGTCTAATTCAGGCCTTGCAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425244    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022567.2-2283s21c1
Sequence:CCGGCCCATTACACCGAAGTCCTTTCTCGAGAAAGGACTTCGGTGTAATGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083318    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022567.1-2532s1c1
Sequence:CCGGCCTAGCCACAAAGGAACTTTACTCGAGTAAAGTTCCTTTGTGGCTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083320    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022567.1-869s1c1
Sequence:CCGGGCCGCCTAGACCTAGCAGCCTCTCGAGAGGCTGCTAGGTCTAGGCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083321    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022567.1-1828s1c1
Sequence:CCGGCCCTGGTTTCTCCTCGCCTCTCTCGAGAGAGGCGAGGAGAAACCAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083322    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022567.1-1155s1c1
Sequence:CCGGGCATCTGCTGCTCAACGACAACTCGAGTTGTCGTTGAGCAGCAGATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022567
NYX MISSION shRNA Lentiviral Transduction Particles
nyctalopin
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000446194    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022567.2-2207s21c1
Sequence:CCGGGCCTGCAAGGCCTGAATTAGACTCGAGTCTAATTCAGGCCTTGCAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425244    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022567.2-2283s21c1
Sequence:CCGGCCCATTACACCGAAGTCCTTTCTCGAGAAAGGACTTCGGTGTAATGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083318    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022567.1-2532s1c1
Sequence:CCGGCCTAGCCACAAAGGAACTTTACTCGAGTAAAGTTCCTTTGTGGCTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083320    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022567.1-869s1c1
Sequence:CCGGGCCGCCTAGACCTAGCAGCCTCTCGAGAGGCTGCTAGGTCTAGGCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083321    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022567.1-1828s1c1
Sequence:CCGGCCCTGGTTTCTCCTCGCCTCTCTCGAGAGAGGCGAGGAGAAACCAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083322    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022567.1-1155s1c1
Sequence:CCGGGCATCTGCTGCTCAACGACAACTCGAGTTGTCGTTGAGCAGCAGATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173415
NYX MISSION shRNA Bacterial Glycerol Stock
nyctalopin
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000200912    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173415.2-4429s1c1
Sequence:CCGGCCACAATTGATCCCTCAGTATCTCGAGATACTGAGGGATCAATTGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201151    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173415.2-2183s1c1
Sequence:CCGGCCACAATAACCTGTCCTTCATCTCGAGATGAAGGACAGGTTATTGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000258071    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173415.4-1743s21c1
Sequence:CCGGAGGAATGGGATTGGTAGTTAACTCGAGTTAACTACCAATCCCATTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250730    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173415.4-1478s21c1
Sequence:CCGGCTGTGGAGGAGGTAGCCAATACTCGAGTATTGGCTACCTCCTCCACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250731    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173415.4-1562s21c1
Sequence:CCGGTCTGCTACAAGGCCACGTTTCCTCGAGGAAACGTGGCCTTGTAGCAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250733    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173415.4-1058s21c1
Sequence:CCGGACCGCAACAGCATCACCTTTGCTCGAGCAAAGGTGATGCTGTTGCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250732    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173415.4-1365s21c1
Sequence:CCGGCCCTGATGAACTGAACTTTACCTCGAGGTAAAGTTCAGTTCATCAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216978    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173415.4-1365s1c1
Sequence:CCGGCCCTGATGAACTGAACTTTACCTCGAGGTAAAGTTCAGTTCATCAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173415
NYX MISSION shRNA shRNA Plasmid DNA
nyctalopin
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000200912    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173415.2-4429s1c1
Sequence:CCGGCCACAATTGATCCCTCAGTATCTCGAGATACTGAGGGATCAATTGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000201151    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173415.2-2183s1c1
Sequence:CCGGCCACAATAACCTGTCCTTCATCTCGAGATGAAGGACAGGTTATTGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000258071    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173415.4-1743s21c1
Sequence:CCGGAGGAATGGGATTGGTAGTTAACTCGAGTTAACTACCAATCCCATTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250730    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173415.4-1478s21c1
Sequence:CCGGCTGTGGAGGAGGTAGCCAATACTCGAGTATTGGCTACCTCCTCCACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250731    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173415.4-1562s21c1
Sequence:CCGGTCTGCTACAAGGCCACGTTTCCTCGAGGAAACGTGGCCTTGTAGCAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250733    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173415.4-1058s21c1
Sequence:CCGGACCGCAACAGCATCACCTTTGCTCGAGCAAAGGTGATGCTGTTGCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250732    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173415.4-1365s21c1
Sequence:CCGGCCCTGATGAACTGAACTTTACCTCGAGGTAAAGTTCAGTTCATCAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000216978    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173415.4-1365s1c1
Sequence:CCGGCCCTGATGAACTGAACTTTACCTCGAGGTAAAGTTCAGTTCATCAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173415
NYX MISSION shRNA Lentiviral Transduction Particles
nyctalopin
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000200912    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173415.2-4429s1c1
Sequence:CCGGCCACAATTGATCCCTCAGTATCTCGAGATACTGAGGGATCAATTGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201151    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173415.2-2183s1c1
Sequence:CCGGCCACAATAACCTGTCCTTCATCTCGAGATGAAGGACAGGTTATTGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000258071    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173415.4-1743s21c1
Sequence:CCGGAGGAATGGGATTGGTAGTTAACTCGAGTTAACTACCAATCCCATTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250730    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173415.4-1478s21c1
Sequence:CCGGCTGTGGAGGAGGTAGCCAATACTCGAGTATTGGCTACCTCCTCCACAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250731    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173415.4-1562s21c1
Sequence:CCGGTCTGCTACAAGGCCACGTTTCCTCGAGGAAACGTGGCCTTGTAGCAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250733    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173415.4-1058s21c1
Sequence:CCGGACCGCAACAGCATCACCTTTGCTCGAGCAAAGGTGATGCTGTTGCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250732    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173415.4-1365s21c1
Sequence:CCGGCCCTGATGAACTGAACTTTACCTCGAGGTAAAGTTCAGTTCATCAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216978    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173415.4-1365s1c1
Sequence:CCGGCCCTGATGAACTGAACTTTACCTCGAGGTAAAGTTCAGTTCATCAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)