EMAIL THIS PAGE TO A FRIEND

OARD1

O-acyl-ADP-ribose deacylase 1

60 Gene Product Result for
Synonyms: C6orf130 TARG1 dJ34B21.3
UniProtKB ID: Q9Y530, A6NEK4, A8K4H4, Q96F23
Gene ID:
Mouse(106821) O-acyl-ADP-ribose deacylase 1
Zebrafish(553793) O-acyl-ADP-ribose deacylase 1
cow(768056) chromosome 23 open reading frame, human C6orf130
sheep(101104185) O-acyl-ADP-ribose deacylase 1
naked mole-rat(101719223) O-acyl-ADP-ribose deacylase 1
domestic guinea pig(100718231) O-acyl-ADP-ribose deacylase 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA029036 Anti-OARD1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_145063 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_145063 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_145063 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_207219 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_207219 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_207219 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_145063 Rosetta Predictions human pricing
NM_207219 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145063 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00165859 predicted 618
2 SASI_Hs02_00364965 predicted 874
3 SASI_Hs01_00165860 predicted 258
4 SASI_Hs01_00165861 predicted 521
5 SASI_Hs01_00165862 predicted 712
6 SASI_Hs02_00364966 predicted 775
7 SASI_Hs01_00165863 predicted 754
8 SASI_Hs02_00364967 predicted 609
9 SASI_Hs01_00165864 predicted 903
10 SASI_Hs01_00165865 predicted 570
11 SASI_Hs01_00165856 predicted 767
12 SASI_Hs01_00165857 predicted 732
13 SASI_Hs01_00165858 predicted 250
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207219 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00087364 predicted 606
2 SASI_Mm01_00087365 predicted 417
3 SASI_Mm02_00351939 predicted 289
4 SASI_Mm01_00087366 predicted 463
5 SASI_Mm01_00087367 predicted 465
6 SASI_Mm01_00087368 predicted 387
7 SASI_Mm02_00351940 predicted 215
8 SASI_Mm01_00087369 predicted 592
9 SASI_Mm01_00087370 predicted 405
10 SASI_Mm01_00087371 predicted 359
11 SASI_Mm01_00087372 predicted 252
12 SASI_Mm01_00087373 predicted 510
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145063
VALIDATED
OARD1 MISSION shRNA Bacterial Glycerol Stock
O-acyl-ADP-ribose deacylase 1
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000130281    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_145063.2-435s1c1
Sequence:CCGGCGCACAAGCCAACTTATGAAACTCGAGTTTCATAAGTTGGCTTGTGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128685    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_145063.2-1002s1c1
Sequence:CCGGCATTCCAGTTAGTTTGGCATTCTCGAGAATGCCAAACTAACTGGAATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128282    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_145063.2-463s1c1
Sequence:CCGGGAAGAGTTTAGAGGCAATGAACTCGAGTTCATTGCCTCTAAACTCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129418    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_145063.2-572s1c1
Sequence:CCGGGCGATGATCGAGGAGGTATTTCTCGAGAAATACCTCCTCGATCATCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129341    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145063.2-542s1c1
Sequence:CCGGCTTGATCGTCTGCAATGGGAACTCGAGTTCCCATTGCAGACGATCAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000439649    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145063.2-690s21c1
Sequence:CCGGGACCGGGCAAACCTACCTTAACTCGAGTTAAGGTAGGTTTGCCCGGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429881    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145063.2-216s21c1
Sequence:CCGGCTTATGTGAAAGGAGACCTTTCTCGAGAAAGGTCTCCTTTCACATAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414259    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145063.2-383s21c1
Sequence:CCGGCTGAAGAGAGATGGGCGATATCTCGAGATATCGCCCATCTCTCTTCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414189    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145063.2-527s21c1
Sequence:CCGGAGGATTGGATGTGGTCTTGATCTCGAGATCAAGACCACATCCAATCCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428045    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145063.2-625s21c1
Sequence:CCGGACTCTGAACCAGTGAACATTTCTCGAGAAATGTTCACTGGTTCAGAGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436540    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145063.2-203s21c1
Sequence:CCGGGGAAGCAGAATCACTTATGTGCTCGAGCACATAAGTGATTCTGCTTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145063
VALIDATED
OARD1 MISSION shRNA shRNA Plasmid DNA
O-acyl-ADP-ribose deacylase 1
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000130281    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_145063.2-435s1c1
Sequence:CCGGCGCACAAGCCAACTTATGAAACTCGAGTTTCATAAGTTGGCTTGTGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128685    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_145063.2-1002s1c1
Sequence:CCGGCATTCCAGTTAGTTTGGCATTCTCGAGAATGCCAAACTAACTGGAATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128282    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_145063.2-463s1c1
Sequence:CCGGGAAGAGTTTAGAGGCAATGAACTCGAGTTCATTGCCTCTAAACTCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129418    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_145063.2-572s1c1
Sequence:CCGGGCGATGATCGAGGAGGTATTTCTCGAGAAATACCTCCTCGATCATCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129341    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145063.2-542s1c1
Sequence:CCGGCTTGATCGTCTGCAATGGGAACTCGAGTTCCCATTGCAGACGATCAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000439649    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145063.2-690s21c1
Sequence:CCGGGACCGGGCAAACCTACCTTAACTCGAGTTAAGGTAGGTTTGCCCGGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429881    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145063.2-216s21c1
Sequence:CCGGCTTATGTGAAAGGAGACCTTTCTCGAGAAAGGTCTCCTTTCACATAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414259    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145063.2-383s21c1
Sequence:CCGGCTGAAGAGAGATGGGCGATATCTCGAGATATCGCCCATCTCTCTTCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414189    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145063.2-527s21c1
Sequence:CCGGAGGATTGGATGTGGTCTTGATCTCGAGATCAAGACCACATCCAATCCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428045    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145063.2-625s21c1
Sequence:CCGGACTCTGAACCAGTGAACATTTCTCGAGAAATGTTCACTGGTTCAGAGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000436540    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145063.2-203s21c1
Sequence:CCGGGGAAGCAGAATCACTTATGTGCTCGAGCACATAAGTGATTCTGCTTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145063
VALIDATED
OARD1 MISSION shRNA Lentiviral Transduction Particles
O-acyl-ADP-ribose deacylase 1
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000130281    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_145063.2-435s1c1
Sequence:CCGGCGCACAAGCCAACTTATGAAACTCGAGTTTCATAAGTTGGCTTGTGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128685    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_145063.2-1002s1c1
Sequence:CCGGCATTCCAGTTAGTTTGGCATTCTCGAGAATGCCAAACTAACTGGAATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128282    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_145063.2-463s1c1
Sequence:CCGGGAAGAGTTTAGAGGCAATGAACTCGAGTTCATTGCCTCTAAACTCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129418    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_145063.2-572s1c1
Sequence:CCGGGCGATGATCGAGGAGGTATTTCTCGAGAAATACCTCCTCGATCATCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129341    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145063.2-542s1c1
Sequence:CCGGCTTGATCGTCTGCAATGGGAACTCGAGTTCCCATTGCAGACGATCAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000439649    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145063.2-690s21c1
Sequence:CCGGGACCGGGCAAACCTACCTTAACTCGAGTTAAGGTAGGTTTGCCCGGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429881    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145063.2-216s21c1
Sequence:CCGGCTTATGTGAAAGGAGACCTTTCTCGAGAAAGGTCTCCTTTCACATAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414259    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145063.2-383s21c1
Sequence:CCGGCTGAAGAGAGATGGGCGATATCTCGAGATATCGCCCATCTCTCTTCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414189    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145063.2-527s21c1
Sequence:CCGGAGGATTGGATGTGGTCTTGATCTCGAGATCAAGACCACATCCAATCCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428045    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145063.2-625s21c1
Sequence:CCGGACTCTGAACCAGTGAACATTTCTCGAGAAATGTTCACTGGTTCAGAGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436540    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145063.2-203s21c1
Sequence:CCGGGGAAGCAGAATCACTTATGTGCTCGAGCACATAAGTGATTCTGCTTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_207219
VALIDATED
OARD1 MISSION shRNA Bacterial Glycerol Stock
O-acyl-ADP-ribose deacylase 1
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000200776    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207219.1-364s1c1
Sequence:CCGGGAAGTCCCATTGTTTGAAGAACTCGAGTTCTTCAAACAATGGGACTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191203    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207219.1-221s1c1
Sequence:CCGGCAGGAACTGTTAAGTCAACAACTCGAGTTGTTGACTTAACAGTTCCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250272    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_207219.3-408s21c1
Sequence:CCGGTGAAGAGAGATGGGCGATATACTCGAGTATATCGCCCATCTCTCTTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250274    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_207219.3-957s21c1
Sequence:CCGGGAAATTGTGGGAAGGGTAAACCTCGAGGTTTACCCTTCCCACAATTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250276    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_207219.3-231s21c1
Sequence:CCGGGTCGAATCACTTACGTGAAAGCTCGAGCTTTCACGTAAGTGATTCGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217524    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207219.3-409s1c1
Sequence:CCGGGAAGAGAGATGGGCGATATATCTCGAGATATATCGCCCATCTCTCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250275    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_207219.3-278s21c1
Sequence:CCGGGACTCTCTAGCCCATTGTATCCTCGAGGATACAATGGGCTAGAGAGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250273    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_207219.3-308s21c1
Sequence:CCGGTGTCGAATGGGTGCTGGAATACTCGAGTATTCCAGCACCCATTCGACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_207219
VALIDATED
OARD1 MISSION shRNA shRNA Plasmid DNA
O-acyl-ADP-ribose deacylase 1
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000200776    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207219.1-364s1c1
Sequence:CCGGGAAGTCCCATTGTTTGAAGAACTCGAGTTCTTCAAACAATGGGACTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000191203    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207219.1-221s1c1
Sequence:CCGGCAGGAACTGTTAAGTCAACAACTCGAGTTGTTGACTTAACAGTTCCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250272    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_207219.3-408s21c1
Sequence:CCGGTGAAGAGAGATGGGCGATATACTCGAGTATATCGCCCATCTCTCTTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250274    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_207219.3-957s21c1
Sequence:CCGGGAAATTGTGGGAAGGGTAAACCTCGAGGTTTACCCTTCCCACAATTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250276    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_207219.3-231s21c1
Sequence:CCGGGTCGAATCACTTACGTGAAAGCTCGAGCTTTCACGTAAGTGATTCGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000217524    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207219.3-409s1c1
Sequence:CCGGGAAGAGAGATGGGCGATATATCTCGAGATATATCGCCCATCTCTCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250275    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_207219.3-278s21c1
Sequence:CCGGGACTCTCTAGCCCATTGTATCCTCGAGGATACAATGGGCTAGAGAGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250273    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_207219.3-308s21c1
Sequence:CCGGTGTCGAATGGGTGCTGGAATACTCGAGTATTCCAGCACCCATTCGACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_207219
VALIDATED
OARD1 MISSION shRNA Lentiviral Transduction Particles
O-acyl-ADP-ribose deacylase 1
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000200776    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207219.1-364s1c1
Sequence:CCGGGAAGTCCCATTGTTTGAAGAACTCGAGTTCTTCAAACAATGGGACTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191203    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207219.1-221s1c1
Sequence:CCGGCAGGAACTGTTAAGTCAACAACTCGAGTTGTTGACTTAACAGTTCCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250272    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_207219.3-408s21c1
Sequence:CCGGTGAAGAGAGATGGGCGATATACTCGAGTATATCGCCCATCTCTCTTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250274    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_207219.3-957s21c1
Sequence:CCGGGAAATTGTGGGAAGGGTAAACCTCGAGGTTTACCCTTCCCACAATTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250276    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_207219.3-231s21c1
Sequence:CCGGGTCGAATCACTTACGTGAAAGCTCGAGCTTTCACGTAAGTGATTCGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217524    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207219.3-409s1c1
Sequence:CCGGGAAGAGAGATGGGCGATATATCTCGAGATATATCGCCCATCTCTCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250275    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_207219.3-278s21c1
Sequence:CCGGGACTCTCTAGCCCATTGTATCCTCGAGGATACAATGGGCTAGAGAGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250273    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_207219.3-308s21c1
Sequence:CCGGTGTCGAATGGGTGCTGGAATACTCGAGTATTCCAGCACCCATTCGACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)