EMAIL THIS PAGE TO A FRIEND

OAS2

2'-5'-oligoadenylate synthetase 2, 69/71kDa

93 Gene Product Result for
UniProtKB ID: P29728, A8K9T1, Q6PJ33, Q86XX8
Gene ID:
Human(4939) Summary: This gene encodes a member of the 2-5A synthetase family, essential proteins involved in the innate immune response to viral infection. The encoded protein is induced by interferons and uses adenosine triphosphate in 2'-specific nucleotidyl transfer reactions to synthesize 2',5'-oligoadenylates (2-5As). These molecules activate latent RNase L, which results in viral RNA degradation and the inhibition of viral replication. The three known members of this gene family are located in a cluster on chromosome 12. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
Mouse(246728) 2'-5' oligoadenylate synthetase 2
Rat(363938) 2'-5' oligoadenylate synthetase 2
cow(529660) 2'-5'-oligoadenylate synthetase 2, 69/71kDa
Horse(791250) 2'-5'-oligoadenylate synthetase 2, 69/71kDa
dog(611051) 2'-5'-oligoadenylate synthetase 2, 69/71kDa
domestic guinea pig(100722402) 2'-5'-oligoadenylate synthetase 2, 69/71kDa
naked mole-rat(101698818) 2'-5'-oligoadenylate synthetase 2, 69/71kDa
sheep(101109915) 2'-5'-oligoadenylate synthetase 2, 69/71kDa
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002535 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002535 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002535 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_145227 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145227 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145227 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU131821 MISSION® esiRNA esiRNA human OAS2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001032731 Rosetta Predictions human pricing
NM_002535 Rosetta Predictions human pricing
NM_016817 Rosetta Predictions human pricing
NM_001009715 Rosetta Predictions rat pricing
XM_579314 Rosetta Predictions rat pricing
NM_145227 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001032731 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00054392 predicted 344
2 SASI_Hs02_00307960 predicted 367
3 SASI_Hs01_00054393 predicted 224
4 SASI_Hs01_00054394 predicted 209
5 SASI_Hs01_00054395 predicted 307
6 SASI_Hs01_00054397 predicted 213
7 SASI_Hs01_00054398 predicted 239
8 SASI_Hs01_00054399 predicted 217
9 SASI_Hs01_00054400 predicted 206
10 SASI_Hs01_00054401 predicted 235
11 SASI_Hs01_00054396 predicted 231
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002535 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00105912 predicted 351
2 SASI_Hs02_00334016 predicted 359
3 SASI_Hs01_00105913 predicted 225
4 SASI_Hs01_00105914 predicted 206
5 SASI_Hs01_00105915 predicted 308
6 SASI_Hs01_00105917 predicted 210
7 SASI_Hs01_00105918 predicted 241
8 SASI_Hs01_00105919 predicted 213
9 SASI_Hs01_00105920 predicted 207
10 SASI_Hs01_00105921 predicted 229
11 SASI_Hs01_00105916 predicted 238
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016817 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00122308 predicted 343
2 SASI_Hs02_00349871 predicted 359
3 SASI_Hs01_00122309 predicted 227
4 SASI_Hs01_00122310 predicted 200
5 SASI_Hs01_00122311 predicted 304
6 SASI_Hs01_00122313 predicted 211
7 SASI_Hs01_00122314 predicted 238
8 SASI_Hs01_00122315 predicted 217
9 SASI_Hs01_00122316 predicted 211
10 SASI_Hs01_00122317 predicted 232
11 SASI_Hs01_00122312 predicted 237
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001009715 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00040867 predicted 468
2 SASI_Rn01_00040868 predicted 420
3 SASI_Rn01_00040869 predicted 1647
4 SASI_Rn01_00040870 predicted 1204
5 SASI_Rn01_00040871 predicted 1579
6 SASI_Rn02_00199779 predicted 961
7 SASI_Rn01_00040872 predicted 742
8 SASI_Rn01_00040874 predicted 1627
9 SASI_Rn02_00199780 predicted 486
10 SASI_Rn02_00199781 predicted 623
11 SASI_Rn01_00040865 predicted 1385
12 SASI_Rn01_00040866 predicted 1749
13 SASI_Rn01_00040873 predicted 1091
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_579314 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00156020 predicted 1748
2 SASI_Rn01_00156021 predicted 476
3 SASI_Rn01_00156022 predicted 712
4 SASI_Rn01_00156023 predicted 425
5 SASI_Rn01_00156024 predicted 1648
6 SASI_Rn01_00156025 predicted 1576
7 SASI_Rn01_00156026 predicted 742
8 SASI_Rn01_00156027 predicted 1083
9 SASI_Rn01_00156028 predicted 1637
10 SASI_Rn01_00156029 predicted 490
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145227 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00340606 predicted 1585
2 SASI_Mm01_00079779 predicted 1642
3 SASI_Mm01_00079780 predicted 1080
4 SASI_Mm01_00079781 predicted 608
5 SASI_Mm02_00340607 predicted 1933
6 SASI_Mm01_00079782 predicted 2010
7 SASI_Mm01_00079783 predicted 577
8 SASI_Mm01_00079785 predicted 771
9 SASI_Mm01_00079786 predicted 1814
10 SASI_Mm01_00079784 predicted 2182
11 SASI_Mm01_00079787 predicted 1169
12 SASI_Mm01_00079788 predicted 2192
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002535
VALIDATED
OAS2 MISSION shRNA Bacterial Glycerol Stock
2'-5'-oligoadenylate synthetase 2, 69/71kDa
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000431526    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002535.2-814s21c1
Sequence:CCGGTGGAGCTGCTTACGGTGTATGCTCGAGCATACACCGTAAGCAGCTCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414756    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002535.2-1958s21c1
Sequence:CCGGCATCTTCTGGAAGGTCAATTACTCGAGTAATTGACCTTCCAGAAGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412704    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002535.2-889s21c1
Sequence:CCGGCCGTACTGGAGCTGATCAAATCTCGAGATTTGATCAGCTCCAGTACGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005020    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002535.1-298s1c1
Sequence:CCGGCCAACGTGACATCCTCGATAACTCGAGTTATCGAGGATGTCACGTTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005017    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_002535.1-2409s1c1
Sequence:CCGGCCACCCTCTTTAGCTGTTAATCTCGAGATTAACAGCTAAAGAGGGTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005018    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_002535.1-1625s1c1
Sequence:CCGGCCCACCAAACTAAAGGATTTACTCGAGTAAATCCTTTAGTTTGGTGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005019    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002535.1-1165s1c1
Sequence:CCGGCCGACAATCAACAGCCAAGATCTCGAGATCTTGGCTGTTGATTGTCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429158    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002535.2-2258s21c1
Sequence:CCGGCCTACTGTAGCAACCTGAAATCTCGAGATTTCAGGTTGCTACAGTAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005021    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_002535.1-1529s1c1
Sequence:CCGGGCAGGGCTCATTGATCTGTATCTCGAGATACAGATCAATGAGCCCTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002535
VALIDATED
OAS2 MISSION shRNA shRNA Plasmid DNA
2'-5'-oligoadenylate synthetase 2, 69/71kDa
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000431526    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002535.2-814s21c1
Sequence:CCGGTGGAGCTGCTTACGGTGTATGCTCGAGCATACACCGTAAGCAGCTCCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414756    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002535.2-1958s21c1
Sequence:CCGGCATCTTCTGGAAGGTCAATTACTCGAGTAATTGACCTTCCAGAAGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000412704    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002535.2-889s21c1
Sequence:CCGGCCGTACTGGAGCTGATCAAATCTCGAGATTTGATCAGCTCCAGTACGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005020    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002535.1-298s1c1
Sequence:CCGGCCAACGTGACATCCTCGATAACTCGAGTTATCGAGGATGTCACGTTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005017    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_002535.1-2409s1c1
Sequence:CCGGCCACCCTCTTTAGCTGTTAATCTCGAGATTAACAGCTAAAGAGGGTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005018    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_002535.1-1625s1c1
Sequence:CCGGCCCACCAAACTAAAGGATTTACTCGAGTAAATCCTTTAGTTTGGTGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005019    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002535.1-1165s1c1
Sequence:CCGGCCGACAATCAACAGCCAAGATCTCGAGATCTTGGCTGTTGATTGTCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429158    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002535.2-2258s21c1
Sequence:CCGGCCTACTGTAGCAACCTGAAATCTCGAGATTTCAGGTTGCTACAGTAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005021    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_002535.1-1529s1c1
Sequence:CCGGGCAGGGCTCATTGATCTGTATCTCGAGATACAGATCAATGAGCCCTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002535
VALIDATED
OAS2 MISSION shRNA Lentiviral Transduction Particles
2'-5'-oligoadenylate synthetase 2, 69/71kDa
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000431526    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002535.2-814s21c1
Sequence:CCGGTGGAGCTGCTTACGGTGTATGCTCGAGCATACACCGTAAGCAGCTCCATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414756    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002535.2-1958s21c1
Sequence:CCGGCATCTTCTGGAAGGTCAATTACTCGAGTAATTGACCTTCCAGAAGATGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000412704    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002535.2-889s21c1
Sequence:CCGGCCGTACTGGAGCTGATCAAATCTCGAGATTTGATCAGCTCCAGTACGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005020    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002535.1-298s1c1
Sequence:CCGGCCAACGTGACATCCTCGATAACTCGAGTTATCGAGGATGTCACGTTGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005017    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_002535.1-2409s1c1
Sequence:CCGGCCACCCTCTTTAGCTGTTAATCTCGAGATTAACAGCTAAAGAGGGTGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005018    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_002535.1-1625s1c1
Sequence:CCGGCCCACCAAACTAAAGGATTTACTCGAGTAAATCCTTTAGTTTGGTGGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005019    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002535.1-1165s1c1
Sequence:CCGGCCGACAATCAACAGCCAAGATCTCGAGATCTTGGCTGTTGATTGTCGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429158    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002535.2-2258s21c1
Sequence:CCGGCCTACTGTAGCAACCTGAAATCTCGAGATTTCAGGTTGCTACAGTAGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005021    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_002535.1-1529s1c1
Sequence:CCGGGCAGGGCTCATTGATCTGTATCTCGAGATACAGATCAATGAGCCCTGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145227
OAS2 MISSION shRNA Bacterial Glycerol Stock
2'-5'-oligoadenylate synthetase 2, 69/71kDa
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000075816    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145227.1-534s1c1
Sequence:CCGGGCAGAGAATACTCCTGCAATTCTCGAGAATTGCAGGAGTATTCTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075813    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145227.1-3721s1c1
Sequence:CCGGCCCACCAAATTCTCTGGATAACTCGAGTTATCCAGAGAATTTGGTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075815    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145227.1-1020s1c1
Sequence:CCGGCCCAACCAATAATGTGGGCAACTCGAGTTGCCCACATTATTGGTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075817    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145227.1-200s1c1
Sequence:CCGGCGCAGAAGCTAGAAGGGTATACTCGAGTATACCCTTCTAGCTTCTGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075814    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145227.1-1021s1c1
Sequence:CCGGCCAACCAATAATGTGGGCAAACTCGAGTTTGCCCACATTATTGGTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145227
OAS2 MISSION shRNA shRNA Plasmid DNA
2'-5'-oligoadenylate synthetase 2, 69/71kDa
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000075816    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145227.1-534s1c1
Sequence:CCGGGCAGAGAATACTCCTGCAATTCTCGAGAATTGCAGGAGTATTCTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075813    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145227.1-3721s1c1
Sequence:CCGGCCCACCAAATTCTCTGGATAACTCGAGTTATCCAGAGAATTTGGTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075815    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145227.1-1020s1c1
Sequence:CCGGCCCAACCAATAATGTGGGCAACTCGAGTTGCCCACATTATTGGTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075817    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145227.1-200s1c1
Sequence:CCGGCGCAGAAGCTAGAAGGGTATACTCGAGTATACCCTTCTAGCTTCTGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075814    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145227.1-1021s1c1
Sequence:CCGGCCAACCAATAATGTGGGCAAACTCGAGTTTGCCCACATTATTGGTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145227
OAS2 MISSION shRNA Lentiviral Transduction Particles
2'-5'-oligoadenylate synthetase 2, 69/71kDa
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000075816    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145227.1-534s1c1
Sequence:CCGGGCAGAGAATACTCCTGCAATTCTCGAGAATTGCAGGAGTATTCTCTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075813    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145227.1-3721s1c1
Sequence:CCGGCCCACCAAATTCTCTGGATAACTCGAGTTATCCAGAGAATTTGGTGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075815    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145227.1-1020s1c1
Sequence:CCGGCCCAACCAATAATGTGGGCAACTCGAGTTGCCCACATTATTGGTTGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075817    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145227.1-200s1c1
Sequence:CCGGCGCAGAAGCTAGAAGGGTATACTCGAGTATACCCTTCTAGCTTCTGCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075814    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145227.1-1021s1c1
Sequence:CCGGCCAACCAATAATGTGGGCAAACTCGAGTTTGCCCACATTATTGGTTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)