EMAIL THIS PAGE TO A FRIEND

OAS3

2'-5'-oligoadenylate synthetase 3, 100kDa

160 Gene Product Result for
Synonyms: p100
UniProtKB ID: Q9Y6K5, Q2HJ14, Q9H3P5
Gene ID:
Human(4940) Summary: This gene encodes an enzyme included in the 2', 5' oligoadenylate synthase family. This enzyme is induced by interferons and catalyzes the 2', 5' oligomers of adenosine in order to bind and activate RNase L. This enzyme family plays a significant role in the inhibition of cellular protein synthesis and viral infection resistance. [provided by RefSeq, Jul 2008]
Mouse(246727) 2'-5' oligoadenylate synthetase 3
Rat(494202) 2 ' -5 ' -oligoadenylate synthetase 3
domestic guinea pig(100722126) 2'-5'-oligoadenylate synthetase 3, 100kDa
domestic cat(101088116) 2'-5'-oligoadenylate synthetase 3, 100kDa
Horse(791225) 2'-5'-oligoadenylate synthetase 3, 100kDa
dog(477490) 2'-5'-oligoadenylate synthetase 3, 100kDa
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006187 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006187 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006187 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_145226 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145226 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145226 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006187 Rosetta Predictions human pricing
NM_001009493 Rosetta Predictions rat pricing
NM_145226 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006187 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00104798 predicted 1867
2 SASI_Hs01_00104799 predicted 2463
3 SASI_Hs01_00104800 predicted 2413
4 SASI_Hs01_00104801 predicted 530
5 SASI_Hs01_00104802 predicted 1051
6 SASI_Hs01_00104803 predicted 1199
7 SASI_Hs01_00104804 predicted 2758
8 SASI_Hs01_00104805 predicted 310
9 SASI_Hs01_00104806 predicted 2141
10 SASI_Hs01_00104807 predicted 676
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001009493 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00199563 predicted 2512
2 SASI_Rn01_00032215 predicted 1307
3 SASI_Rn01_00032216 predicted 2551
4 SASI_Rn01_00032217 predicted 914
5 SASI_Rn01_00032218 predicted 1098
6 SASI_Rn01_00032219 predicted 2182
7 SASI_Rn01_00032220 predicted 2433
8 SASI_Rn01_00032222 predicted 3205
9 SASI_Rn01_00032223 predicted 833
10 SASI_Rn02_00199564 predicted 1275
11 SASI_Rn01_00032214 predicted 594
12 SASI_Rn01_00032221 predicted 1528
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145226 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00113690 predicted 391
2 SASI_Mm01_00113691 predicted 1177
3 SASI_Mm01_00113692 predicted 2516
4 SASI_Mm01_00113693 predicted 994
5 SASI_Mm02_00340605 predicted 523
6 SASI_Mm01_00113694 predicted 2514
7 SASI_Mm01_00113695 predicted 2565
8 SASI_Mm01_00113696 predicted 1258
9 SASI_Mm01_00113698 predicted 1936
10 SASI_Mm01_00113699 predicted 2450
11 SASI_Mm01_00113697 predicted 562
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006187
OAS3 MISSION shRNA Bacterial Glycerol Stock
2'-5'-oligoadenylate synthetase 3, 100kDa
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000005013    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006187.1-596s1c1
Sequence:CCGGCGGAGGAACTTTGTGAACATTCTCGAGAATGTTCACAAAGTTCCTCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005015    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006187.1-2078s1c1
Sequence:CCGGGCCATGAGAATGCACCTTCTTCTCGAGAAGAAGGTGCATTCTCATGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005016    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006187.1-519s1c1
Sequence:CCGGCCAAGCCACAAGTCTACTCTACTCGAGTAGAGTAGACTTGTGGCTTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005014    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006187.1-2362s1c1
Sequence:CCGGCGTTGATACCATCTGTTCATTCTCGAGAATGAACAGATGGTATCAACGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005012    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006187.1-3646s1c1
Sequence:CCGGCCCATGCAAATTAGCTCACATCTCGAGATGTGAGCTAATTTGCATGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320371    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006187.2-1698s21c1
Sequence:CCGGGAAGAGCTGGACGGATGTTAGCTCGAGCTAACATCCGTCCAGCTCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320444    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006187.2-2648s21c1
Sequence:CCGGGGCAGTTCGAGGTCAAGTTTGCTCGAGCAAACTTGACCTCGAACTGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320370    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006187.2-649s21c1
Sequence:CCGGCGGAGGAACTTTGTGAACATTCTCGAGAATGTTCACAAAGTTCCTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320372    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006187.2-2403s21c1
Sequence:CCGGGGTGAACAAGGCCGTTGATACCTCGAGGTATCAACGGCCTTGTTCACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320373    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006187.2-2096s21c1
Sequence:CCGGTCTACTGGACGGTCAACTATACTCGAGTATAGTTGACCGTCCAGTAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006187
OAS3 MISSION shRNA shRNA Plasmid DNA
2'-5'-oligoadenylate synthetase 3, 100kDa
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000005013    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006187.1-596s1c1
Sequence:CCGGCGGAGGAACTTTGTGAACATTCTCGAGAATGTTCACAAAGTTCCTCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005015    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006187.1-2078s1c1
Sequence:CCGGGCCATGAGAATGCACCTTCTTCTCGAGAAGAAGGTGCATTCTCATGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005016    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006187.1-519s1c1
Sequence:CCGGCCAAGCCACAAGTCTACTCTACTCGAGTAGAGTAGACTTGTGGCTTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005014    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006187.1-2362s1c1
Sequence:CCGGCGTTGATACCATCTGTTCATTCTCGAGAATGAACAGATGGTATCAACGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005012    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006187.1-3646s1c1
Sequence:CCGGCCCATGCAAATTAGCTCACATCTCGAGATGTGAGCTAATTTGCATGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000320371    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006187.2-1698s21c1
Sequence:CCGGGAAGAGCTGGACGGATGTTAGCTCGAGCTAACATCCGTCCAGCTCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000320444    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006187.2-2648s21c1
Sequence:CCGGGGCAGTTCGAGGTCAAGTTTGCTCGAGCAAACTTGACCTCGAACTGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000320370    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006187.2-649s21c1
Sequence:CCGGCGGAGGAACTTTGTGAACATTCTCGAGAATGTTCACAAAGTTCCTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000320372    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006187.2-2403s21c1
Sequence:CCGGGGTGAACAAGGCCGTTGATACCTCGAGGTATCAACGGCCTTGTTCACCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000320373    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006187.2-2096s21c1
Sequence:CCGGTCTACTGGACGGTCAACTATACTCGAGTATAGTTGACCGTCCAGTAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006187
OAS3 MISSION shRNA Lentiviral Transduction Particles
2'-5'-oligoadenylate synthetase 3, 100kDa
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000005013    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006187.1-596s1c1
Sequence:CCGGCGGAGGAACTTTGTGAACATTCTCGAGAATGTTCACAAAGTTCCTCCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005015    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006187.1-2078s1c1
Sequence:CCGGGCCATGAGAATGCACCTTCTTCTCGAGAAGAAGGTGCATTCTCATGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005016    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006187.1-519s1c1
Sequence:CCGGCCAAGCCACAAGTCTACTCTACTCGAGTAGAGTAGACTTGTGGCTTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005014    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006187.1-2362s1c1
Sequence:CCGGCGTTGATACCATCTGTTCATTCTCGAGAATGAACAGATGGTATCAACGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005012    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006187.1-3646s1c1
Sequence:CCGGCCCATGCAAATTAGCTCACATCTCGAGATGTGAGCTAATTTGCATGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320371    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006187.2-1698s21c1
Sequence:CCGGGAAGAGCTGGACGGATGTTAGCTCGAGCTAACATCCGTCCAGCTCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320444    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006187.2-2648s21c1
Sequence:CCGGGGCAGTTCGAGGTCAAGTTTGCTCGAGCAAACTTGACCTCGAACTGCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320370    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006187.2-649s21c1
Sequence:CCGGCGGAGGAACTTTGTGAACATTCTCGAGAATGTTCACAAAGTTCCTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320372    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006187.2-2403s21c1
Sequence:CCGGGGTGAACAAGGCCGTTGATACCTCGAGGTATCAACGGCCTTGTTCACCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320373    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006187.2-2096s21c1
Sequence:CCGGTCTACTGGACGGTCAACTATACTCGAGTATAGTTGACCGTCCAGTAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145226
OAS3 MISSION shRNA Bacterial Glycerol Stock
2'-5'-oligoadenylate synthetase 3, 100kDa
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000075825    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145226.1-2018s1c1
Sequence:CCGGCCAGGTTGTCACTCGATATAACTCGAGTTATATCGAGTGACAACCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075824    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145226.1-1739s1c1
Sequence:CCGGCCTCCAGTTTATTGAACAGAACTCGAGTTCTGTTCAATAAACTGGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075826    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145226.1-1527s1c1
Sequence:CCGGCGGGAGAAGAGTGTATACAAACTCGAGTTTGTATACACTCTTCTCCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075827    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145226.1-618s1c1
Sequence:CCGGCCAGCCAAGCTTAAGAACTTACTCGAGTAAGTTCTTAAGCTTGGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075823    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145226.1-4525s1c1
Sequence:CCGGGCTGGTAGTCTTGAGTTCTATCTCGAGATAGAACTCAAGACTACCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145226
OAS3 MISSION shRNA shRNA Plasmid DNA
2'-5'-oligoadenylate synthetase 3, 100kDa
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000075825    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145226.1-2018s1c1
Sequence:CCGGCCAGGTTGTCACTCGATATAACTCGAGTTATATCGAGTGACAACCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075824    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145226.1-1739s1c1
Sequence:CCGGCCTCCAGTTTATTGAACAGAACTCGAGTTCTGTTCAATAAACTGGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075826    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145226.1-1527s1c1
Sequence:CCGGCGGGAGAAGAGTGTATACAAACTCGAGTTTGTATACACTCTTCTCCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075827    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145226.1-618s1c1
Sequence:CCGGCCAGCCAAGCTTAAGAACTTACTCGAGTAAGTTCTTAAGCTTGGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075823    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145226.1-4525s1c1
Sequence:CCGGGCTGGTAGTCTTGAGTTCTATCTCGAGATAGAACTCAAGACTACCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145226
OAS3 MISSION shRNA Lentiviral Transduction Particles
2'-5'-oligoadenylate synthetase 3, 100kDa
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000075825    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145226.1-2018s1c1
Sequence:CCGGCCAGGTTGTCACTCGATATAACTCGAGTTATATCGAGTGACAACCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075824    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145226.1-1739s1c1
Sequence:CCGGCCTCCAGTTTATTGAACAGAACTCGAGTTCTGTTCAATAAACTGGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075826    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145226.1-1527s1c1
Sequence:CCGGCGGGAGAAGAGTGTATACAAACTCGAGTTTGTATACACTCTTCTCCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075827    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145226.1-618s1c1
Sequence:CCGGCCAGCCAAGCTTAAGAACTTACTCGAGTAAGTTCTTAAGCTTGGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075823    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145226.1-4525s1c1
Sequence:CCGGGCTGGTAGTCTTGAGTTCTATCTCGAGATAGAACTCAAGACTACCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)