EMAIL THIS PAGE TO A FRIEND

OASL

2'-5'-oligoadenylate synthetase-like

67 Gene Product Result for
Synonyms: OASLd TRIP-14 TRIP14 p59 OASL p59-OASL p59OASL
Gene ID:
Rat(304545) 2'-5'-oligoadenylate synthetase-like
chicken(395908) 2'-5'-oligoadenylate synthetase-like
dog(477518) oligoadenylate synthetase-like 2
cow(408021) 2'-5'-oligoadenylate synthetase-like
Horse(100009702) 2'-5'-oligoadenylate synthetase-like
dog(100685232) 2'-5'-oligoadenylate synthetase-like
domestic guinea pig(100734390) 2'-5'-oligoadenylate synthetase-like
Domestic Rabbit(100356242) 2'-5'-oligoadenylate synthetase-like
sheep(101120864) 2'-5'-oligoadenylate synthetase-like
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003733 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003733 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003733 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU076721 MISSION® esiRNA esiRNA human OASL (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003733 Rosetta Predictions human pricing
NM_198213 Rosetta Predictions human pricing
NM_001009681 Rosetta Predictions rat pricing
XM_579309 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003733 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00012484 predicted 1421
2 SASI_Hs01_00012485 predicted 1113
3 SASI_Hs01_00012486 predicted 306
4 SASI_Hs01_00012487 predicted 225
5 SASI_Hs01_00012489 predicted 1120
6 SASI_Hs01_00012490 predicted 1105
7 SASI_Hs01_00012491 predicted 1295
8 SASI_Hs01_00012492 predicted 1327
9 SASI_Hs01_00012493 predicted 297
10 SASI_Hs02_00336183 predicted 401
11 SASI_Hs01_00012488 predicted 1252
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198213 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00061791 predicted 1183
2 SASI_Hs01_00061792 predicted 869
3 SASI_Hs01_00061793 predicted 306
4 SASI_Hs01_00061794 predicted 226
5 SASI_Hs01_00061796 predicted 878
6 SASI_Hs01_00061797 predicted 863
7 SASI_Hs01_00061798 predicted 1055
8 SASI_Hs01_00061799 predicted 1094
9 SASI_Hs01_00061800 predicted 292
10 SASI_Hs02_00371745 predicted 405
11 SASI_Hs01_00061795 predicted 1012
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001009681 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00053924 predicted 399
2 SASI_Rn01_00053925 predicted 1038
3 SASI_Rn02_00199723 predicted 315
4 SASI_Rn01_00053926 predicted 517
5 SASI_Rn01_00053927 predicted 1448
6 SASI_Rn01_00053928 predicted 1089
7 SASI_Rn01_00053929 predicted 1446
8 SASI_Rn01_00053930 predicted 1457
9 SASI_Rn01_00053931 predicted 759
10 SASI_Rn01_00053932 predicted 388
11 SASI_Rn01_00053933 predicted 410
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_579309 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00148144 predicted 1685
2 SASI_Rn01_00148145 predicted 1741
3 SASI_Rn01_00148146 predicted 1444
4 SASI_Rn01_00148147 predicted 1454
5 SASI_Rn01_00148148 predicted 1715
6 SASI_Rn01_00148149 predicted 1613
7 SASI_Rn01_00148150 predicted 1674
8 SASI_Rn01_00148151 predicted 1644
9 SASI_Rn01_00148152 predicted 1444
10 SASI_Rn01_00148153 predicted 1393
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003733
OASL MISSION shRNA Bacterial Glycerol Stock
2'-5'-oligoadenylate synthetase-like
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000427334    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003733.2-259s21c1
Sequence:CCGGGTGGCGTTTCTGAGCTGTTTCCTCGAGGAAACAGCTCAGAAACGCCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415630    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003733.2-1304s21c1
Sequence:CCGGAGATCCAGGTCTTCGTGAAGACTCGAGTCTTCACGAAGACCTGGATCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007222    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003733.2-295s1c1
Sequence:CCGGGCAGCCAAGCATCACAAAGATCTCGAGATCTTTGTGATGCTTGGCTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007218    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003733.2-1583s1c1
Sequence:CCGGGCCATGTACTCCAGAACTCATCTCGAGATGAGTTCTGGAGTACATGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007221    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003733.2-1242s1c1
Sequence:CCGGCTTAGCCAAATATGGGATCTTCTCGAGAAGATCCCATATTTGGCTAAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007219    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003733.2-600s1c1
Sequence:CCGGCGTGAAACATCGGCCAACTAACTCGAGTTAGTTGGCCGATGTTTCACGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007220    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003733.2-1126s1c1
Sequence:CCGGGAGCCCATAAGGAAGGTTAAACTCGAGTTTAACCTTCCTTATGGGCTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430812    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003733.2-842s21c1
Sequence:CCGGAGTACTACACACTCCACAATGCTCGAGCATTGTGGAGTGTGTAGTACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003733
OASL MISSION shRNA shRNA Plasmid DNA
2'-5'-oligoadenylate synthetase-like
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000427334    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003733.2-259s21c1
Sequence:CCGGGTGGCGTTTCTGAGCTGTTTCCTCGAGGAAACAGCTCAGAAACGCCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415630    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003733.2-1304s21c1
Sequence:CCGGAGATCCAGGTCTTCGTGAAGACTCGAGTCTTCACGAAGACCTGGATCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000007222    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003733.2-295s1c1
Sequence:CCGGGCAGCCAAGCATCACAAAGATCTCGAGATCTTTGTGATGCTTGGCTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000007218    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003733.2-1583s1c1
Sequence:CCGGGCCATGTACTCCAGAACTCATCTCGAGATGAGTTCTGGAGTACATGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000007221    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003733.2-1242s1c1
Sequence:CCGGCTTAGCCAAATATGGGATCTTCTCGAGAAGATCCCATATTTGGCTAAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000007219    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003733.2-600s1c1
Sequence:CCGGCGTGAAACATCGGCCAACTAACTCGAGTTAGTTGGCCGATGTTTCACGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000007220    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003733.2-1126s1c1
Sequence:CCGGGAGCCCATAAGGAAGGTTAAACTCGAGTTTAACCTTCCTTATGGGCTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430812    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003733.2-842s21c1
Sequence:CCGGAGTACTACACACTCCACAATGCTCGAGCATTGTGGAGTGTGTAGTACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003733
OASL MISSION shRNA Lentiviral Transduction Particles
2'-5'-oligoadenylate synthetase-like
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000427334    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003733.2-259s21c1
Sequence:CCGGGTGGCGTTTCTGAGCTGTTTCCTCGAGGAAACAGCTCAGAAACGCCACTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000415630    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003733.2-1304s21c1
Sequence:CCGGAGATCCAGGTCTTCGTGAAGACTCGAGTCTTCACGAAGACCTGGATCTTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000007222    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003733.2-295s1c1
Sequence:CCGGGCAGCCAAGCATCACAAAGATCTCGAGATCTTTGTGATGCTTGGCTGCTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000007218    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003733.2-1583s1c1
Sequence:CCGGGCCATGTACTCCAGAACTCATCTCGAGATGAGTTCTGGAGTACATGGCTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000007221    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003733.2-1242s1c1
Sequence:CCGGCTTAGCCAAATATGGGATCTTCTCGAGAAGATCCCATATTTGGCTAAGTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000007219    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003733.2-600s1c1
Sequence:CCGGCGTGAAACATCGGCCAACTAACTCGAGTTAGTTGGCCGATGTTTCACGTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000007220    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003733.2-1126s1c1
Sequence:CCGGGAGCCCATAAGGAAGGTTAAACTCGAGTTTAACCTTCCTTATGGGCTCTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000430812    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003733.2-842s21c1
Sequence:CCGGAGTACTACACACTCCACAATGCTCGAGCATTGTGGAGTGTGTAGTACTTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???