EMAIL THIS PAGE TO A FRIEND

OAT

ornithine aminotransferase

69 Gene Product Result for
Synonyms: GACR HOGA OATASE OKT
Gene ID:
Human(4942) Summary: This gene encodes the mitochondrial enzyme ornithine aminotransferase, which is a key enzyme in the pathway that converts arginine and ornithine into the major excitatory and inhibitory neurotransmitters glutamate and GABA. Mutations that result in a deficiency of this enzyme cause the autosomal recessive eye disease Gyrate Atrophy. Alternatively spliced transcript variants encoding different isoforms have been described. Related pseudogenes have been defined on the X chromosome. [provided by RefSeq, Jan 2010]
Mouse(18242) ornithine aminotransferase
Rat(64313) ornithine aminotransferase
domestic guinea pig(100735523) ornithine aminotransferase
naked mole-rat(101704268) ornithine aminotransferase
sheep(101114229) ornithine aminotransferase
fruit fly(40145) Ornithine aminotransferase precursor
Zebrafish(572518) ornithine aminotransferase
domestic cat(101098404) ornithine aminotransferase
cow(505323) ornithine aminotransferase
Horse(100050199) ornithine aminotransferase
dog(477858) ornithine aminotransferase
Zebrafish(404609) organic anion transporter
chicken(426430) ornithine aminotransferase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016978 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_016978 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_016978 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000274 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000274 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000274 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000274 Rosetta Predictions human pricing
NM_022521 Rosetta Predictions rat pricing
NM_016978 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000274 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00220998 predicted 478
2 SASI_Hs01_00220999 predicted 571
3 SASI_Hs01_00221000 predicted 499
4 SASI_Hs01_00221001 predicted 545
5 SASI_Hs01_00221002 predicted 464
6 SASI_Hs01_00221003 predicted 1027
7 SASI_Hs01_00221004 predicted 1149
8 SASI_Hs01_00221005 predicted 426
9 SASI_Hs01_00221007 predicted 1276
10 SASI_Hs02_00302231 predicted 258
11 SASI_Hs01_00221006 predicted 1122
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022521 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00072495 predicted 300
2 SASI_Rn01_00072496 predicted 1152
3 SASI_Rn02_00263269 predicted 260
4 SASI_Rn01_00072497 predicted 710
5 SASI_Rn02_00263270 predicted 944
6 SASI_Rn01_00072498 predicted 506
7 SASI_Rn01_00072500 predicted 1031
8 SASI_Rn01_00072501 predicted 1063
9 SASI_Rn02_00263271 predicted 442
10 SASI_Rn01_00072503 predicted 423
11 SASI_Rn01_00072494 predicted 486
12 SASI_Rn01_00072499 predicted 993
13 SASI_Rn01_00072502 predicted 726
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016978 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00170944 predicted 534
2 SASI_Mm01_00170946 predicted 331
3 SASI_Mm02_00323830 predicted 360
4 SASI_Mm01_00170948 predicted 274
5 SASI_Mm01_00170949 predicted 748
6 SASI_Mm01_00170950 predicted 1439
7 SASI_Mm02_00323831 predicted 1166
8 SASI_Mm01_00170951 predicted 1064
9 SASI_Mm01_00170952 predicted 973
10 SASI_Mm01_00170953 predicted 1533
11 SASI_Mm01_00170945 predicted 273
12 SASI_Mm01_00170947 predicted 1082
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016978
VALIDATED
OAT MISSION shRNA Bacterial Glycerol Stock
ornithine aminotransferase
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000326028    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016978.2-497s21c1
Sequence:CCGGCCTTGGTGAATACGAGGAGTACTCGAGTACTCCTCGTATTCACCAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119737    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016978.1-1687s1c1
Sequence:CCGGGCAGTCATTTACGTGCGTCTTCTCGAGAAGACGCACGTAAATGACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119741    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016978.1-471s1c1
Sequence:CCGGCCTTGGTGAATACGAGGAGTACTCGAGTACTCCTCGTATTCACCAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119738    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016978.1-685s1c1
Sequence:CCGGCCGACCAGTTATGATGGCTTTCTCGAGAAAGCCATCATAACTGGTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119739    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016978.1-1036s1c1
Sequence:CCGGGATGAGATAATGCTGACCATTCTCGAGAATGGTCAGCATTATCTCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119740    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016978.1-723s1c1
Sequence:CCGGCTTTGAAACCATCCCATATAACTCGAGTTATATGGGATGGTTTCAAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326026    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016978.2-749s21c1
Sequence:CCGGCTTTGAAACCATCCCATATAACTCGAGTTATATGGGATGGTTTCAAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326025    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016978.2-711s21c1
Sequence:CCGGCCGACCAGTTATGATGGCTTTCTCGAGAAAGCCATCATAACTGGTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325955    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016978.2-1062s21c1
Sequence:CCGGGATGAGATAATGCTGACCATTCTCGAGAATGGTCAGCATTATCTCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325954    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016978.2-1713s21c1
Sequence:CCGGGCAGTCATTTACGTGCGTCTTCTCGAGAAGACGCACGTAAATGACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016978
VALIDATED
OAT MISSION shRNA shRNA Plasmid DNA
ornithine aminotransferase
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000326028    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016978.2-497s21c1
Sequence:CCGGCCTTGGTGAATACGAGGAGTACTCGAGTACTCCTCGTATTCACCAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000119737    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016978.1-1687s1c1
Sequence:CCGGGCAGTCATTTACGTGCGTCTTCTCGAGAAGACGCACGTAAATGACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000119741    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016978.1-471s1c1
Sequence:CCGGCCTTGGTGAATACGAGGAGTACTCGAGTACTCCTCGTATTCACCAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000119738    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016978.1-685s1c1
Sequence:CCGGCCGACCAGTTATGATGGCTTTCTCGAGAAAGCCATCATAACTGGTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000119739    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016978.1-1036s1c1
Sequence:CCGGGATGAGATAATGCTGACCATTCTCGAGAATGGTCAGCATTATCTCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000119740    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016978.1-723s1c1
Sequence:CCGGCTTTGAAACCATCCCATATAACTCGAGTTATATGGGATGGTTTCAAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000326026    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016978.2-749s21c1
Sequence:CCGGCTTTGAAACCATCCCATATAACTCGAGTTATATGGGATGGTTTCAAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000326025    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016978.2-711s21c1
Sequence:CCGGCCGACCAGTTATGATGGCTTTCTCGAGAAAGCCATCATAACTGGTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000325955    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016978.2-1062s21c1
Sequence:CCGGGATGAGATAATGCTGACCATTCTCGAGAATGGTCAGCATTATCTCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000325954    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016978.2-1713s21c1
Sequence:CCGGGCAGTCATTTACGTGCGTCTTCTCGAGAAGACGCACGTAAATGACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016978
VALIDATED
OAT MISSION shRNA Lentiviral Transduction Particles
ornithine aminotransferase
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000326028    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016978.2-497s21c1
Sequence:CCGGCCTTGGTGAATACGAGGAGTACTCGAGTACTCCTCGTATTCACCAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119737    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016978.1-1687s1c1
Sequence:CCGGGCAGTCATTTACGTGCGTCTTCTCGAGAAGACGCACGTAAATGACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119741    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016978.1-471s1c1
Sequence:CCGGCCTTGGTGAATACGAGGAGTACTCGAGTACTCCTCGTATTCACCAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119738    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016978.1-685s1c1
Sequence:CCGGCCGACCAGTTATGATGGCTTTCTCGAGAAAGCCATCATAACTGGTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119739    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016978.1-1036s1c1
Sequence:CCGGGATGAGATAATGCTGACCATTCTCGAGAATGGTCAGCATTATCTCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119740    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016978.1-723s1c1
Sequence:CCGGCTTTGAAACCATCCCATATAACTCGAGTTATATGGGATGGTTTCAAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326026    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016978.2-749s21c1
Sequence:CCGGCTTTGAAACCATCCCATATAACTCGAGTTATATGGGATGGTTTCAAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326025    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016978.2-711s21c1
Sequence:CCGGCCGACCAGTTATGATGGCTTTCTCGAGAAAGCCATCATAACTGGTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325955    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016978.2-1062s21c1
Sequence:CCGGGATGAGATAATGCTGACCATTCTCGAGAATGGTCAGCATTATCTCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325954    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016978.2-1713s21c1
Sequence:CCGGGCAGTCATTTACGTGCGTCTTCTCGAGAAGACGCACGTAAATGACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000274
VALIDATED
OAT MISSION shRNA Bacterial Glycerol Stock
ornithine aminotransferase
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000034849    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_000274.1-624s1c1
Sequence:CCGGCCCAACCAGTTACGATGGTTTCTCGAGAAACCATCGTAACTGGTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034853    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_000274.1-1240s1c1
Sequence:CCGGCGACTTCGAGATAATGGACTTCTCGAGAAGTCCATTATCTCGAAGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034850    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_000274.1-1326s1c1
Sequence:CCGGGCTTCGAGAGTCCATTGAAATCTCGAGATTTCAATGGACTCTCGAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034852    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_000274.1-127s1c1
Sequence:CCGGGCTACATCTGTTGCAACTAAACTCGAGTTTAGTTGCAACAGATGTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034851    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000274.1-826s1c1
Sequence:CCGGGTTCTCTTTATTGCTGATGAACTCGAGTTCATCAGCAATAAAGAGAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000274
VALIDATED
OAT MISSION shRNA shRNA Plasmid DNA
ornithine aminotransferase
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000034849    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_000274.1-624s1c1
Sequence:CCGGCCCAACCAGTTACGATGGTTTCTCGAGAAACCATCGTAACTGGTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000034853    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_000274.1-1240s1c1
Sequence:CCGGCGACTTCGAGATAATGGACTTCTCGAGAAGTCCATTATCTCGAAGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000034850    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_000274.1-1326s1c1
Sequence:CCGGGCTTCGAGAGTCCATTGAAATCTCGAGATTTCAATGGACTCTCGAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000034852    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_000274.1-127s1c1
Sequence:CCGGGCTACATCTGTTGCAACTAAACTCGAGTTTAGTTGCAACAGATGTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000034851    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000274.1-826s1c1
Sequence:CCGGGTTCTCTTTATTGCTGATGAACTCGAGTTCATCAGCAATAAAGAGAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000274
VALIDATED
OAT MISSION shRNA Lentiviral Transduction Particles
ornithine aminotransferase
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000034849    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_000274.1-624s1c1
Sequence:CCGGCCCAACCAGTTACGATGGTTTCTCGAGAAACCATCGTAACTGGTTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034853    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_000274.1-1240s1c1
Sequence:CCGGCGACTTCGAGATAATGGACTTCTCGAGAAGTCCATTATCTCGAAGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034850    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_000274.1-1326s1c1
Sequence:CCGGGCTTCGAGAGTCCATTGAAATCTCGAGATTTCAATGGACTCTCGAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034852    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_000274.1-127s1c1
Sequence:CCGGGCTACATCTGTTGCAACTAAACTCGAGTTTAGTTGCAACAGATGTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034851    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000274.1-826s1c1
Sequence:CCGGGTTCTCTTTATTGCTGATGAACTCGAGTTCATCAGCAATAAAGAGAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)