EMAIL THIS PAGE TO A FRIEND

OAZ1

ornithine decarboxylase antizyme 1

72 Gene Product Result for
Synonyms: AZI OAZ
UniProtKB ID: P54368, O43382, Q14989, Q92595, Q9UPL9
Gene ID:
Human(4946) Summary: Ornithine decarboxylase catalyzes the conversion of ornithine to putrescine in the first and apparently rate-limiting step in polyamine biosynthesis. The ornithine decarboxylase antizymes play a role in the regulation of polyamine synthesis by binding to and inhibiting ornithine decarboxylase. Antizyme expression is auto-regulated by polyamine-enhanced translational frameshifting. The antizyme encoded by this gene inhibits ornithine decarboxylase and accelerates its degradation. [provided by RefSeq, Jul 2008]
Mouse(18245) ornithine decarboxylase antizyme 1
Rat(25502) ornithine decarboxylase antizyme 1
chicken(395746) ornithine decarboxylase antizyme 1
dog(476749) ornithine decarboxylase antizyme 1
domestic cat(101080766) ornithine decarboxylase antizyme 1
cow(506973) ornithine decarboxylase antizyme 1
Goat(100860946) ornithine decarboxylase antizyme 1
sheep(101121009) ornithine decarboxylase antizyme 1
naked mole-rat(101710181) ornithine decarboxylase antizyme 1
domestic guinea pig(100735313) ornithine decarboxylase antizyme 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008753 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008753 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008753 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004152 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004152 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004152 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004152 Rosetta Predictions human pricing
NM_139081 Rosetta Predictions rat pricing
NM_008753 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004152 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00086270 predicted 339
2 SASI_Hs01_00086271 predicted 388
3 SASI_Hs01_00086272 predicted 359
4 SASI_Hs02_00336999 predicted 371
5 SASI_Hs02_00337000 predicted 361
6 SASI_Hs01_00086275 predicted 527
7 SASI_Hs02_00337001 predicted 718
8 SASI_Hs01_00086276 predicted 434
9 SASI_Hs02_00337002 predicted 361
10 SASI_Hs01_00086279 predicted 386
11 SASI_Hs01_00086273 predicted 412
12 SASI_Hs01_00086274 predicted 339
13 SASI_Hs01_00086277 predicted 326
14 SASI_Hs01_00086278 predicted 710
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_139081 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00041710 predicted 634
2 SASI_Rn01_00041711 predicted 218
3 SASI_Rn01_00041713 predicted 233
4 SASI_Rn01_00041714 predicted 211
5 SASI_Rn01_00041715 predicted 382
6 SASI_Rn01_00041717 predicted 334
7 SASI_Rn01_00041718 predicted 641
8 SASI_Rn01_00041719 predicted 698
9 SASI_Rn02_00268433 predicted 323
10 SASI_Rn02_00268434 predicted 647
11 SASI_Rn01_00041712 predicted 341
12 SASI_Rn01_00041716 predicted 381
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008753 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00177000 predicted 260
2 SASI_Mm01_00177001 predicted 361
3 SASI_Mm01_00177002 predicted 261
4 SASI_Mm01_00177003 predicted 244
5 SASI_Mm01_00177004 predicted 834
6 SASI_Mm01_00177005 predicted 408
7 SASI_Mm01_00177006 predicted 365
8 SASI_Mm01_00177007 predicted 732
9 SASI_Mm01_00177008 predicted 241
10 SASI_Mm01_00177009 predicted 353
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008753
VALIDATED
OAZ1 MISSION shRNA Bacterial Glycerol Stock
ornithine decarboxylase antizyme 1
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000315602    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008753.4-196s21c1
Sequence:CCGGGCCGCACCATGCCGCTTCTTACTCGAGTAAGAAGCGGCATGGTGCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315525    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008753.4-260s21c1
Sequence:CCGGTGCCCTTAATTGCTGTAGTAACTCGAGTTACTACAGCAATTAAGGGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315526    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008753.4-840s21c1
Sequence:CCGGGTCGTGATTGTGCAGAATAAACTCGAGTTTATTCTGCACAATCACGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309063    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008753.4-240s21c1
Sequence:CCGGAGCAGCGAGAGTTCTAGGGTTCTCGAGAACCCTAGAACTCTCGCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099628    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008753.3-196s1c1
Sequence:CCGGGCCGCACCATGCCGCTTCTTACTCGAGTAAGAAGCGGCATGGTGCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099629    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008753.3-240s1c1
Sequence:CCGGAGCAGCGAGAGTTCTAGGGTTCTCGAGAACCCTAGAACTCTCGCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099627    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008753.3-260s1c1
Sequence:CCGGTGCCCTTAATTGCTGTAGTAACTCGAGTTACTACAGCAATTAAGGGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099625    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 1.0 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008753.3-840s1c1
Sequence:CCGGGTCGTGATTGTGCAGAATAAACTCGAGTTTATTCTGCACAATCACGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008753
VALIDATED
OAZ1 MISSION shRNA shRNA Plasmid DNA
ornithine decarboxylase antizyme 1
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000315602    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008753.4-196s21c1
Sequence:CCGGGCCGCACCATGCCGCTTCTTACTCGAGTAAGAAGCGGCATGGTGCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000315525    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008753.4-260s21c1
Sequence:CCGGTGCCCTTAATTGCTGTAGTAACTCGAGTTACTACAGCAATTAAGGGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000315526    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008753.4-840s21c1
Sequence:CCGGGTCGTGATTGTGCAGAATAAACTCGAGTTTATTCTGCACAATCACGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000309063    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008753.4-240s21c1
Sequence:CCGGAGCAGCGAGAGTTCTAGGGTTCTCGAGAACCCTAGAACTCTCGCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000099628    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008753.3-196s1c1
Sequence:CCGGGCCGCACCATGCCGCTTCTTACTCGAGTAAGAAGCGGCATGGTGCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000099629    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008753.3-240s1c1
Sequence:CCGGAGCAGCGAGAGTTCTAGGGTTCTCGAGAACCCTAGAACTCTCGCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000099627    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008753.3-260s1c1
Sequence:CCGGTGCCCTTAATTGCTGTAGTAACTCGAGTTACTACAGCAATTAAGGGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000099625    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 1.0 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008753.3-840s1c1
Sequence:CCGGGTCGTGATTGTGCAGAATAAACTCGAGTTTATTCTGCACAATCACGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008753
VALIDATED
OAZ1 MISSION shRNA Lentiviral Transduction Particles
ornithine decarboxylase antizyme 1
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000315602    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008753.4-196s21c1
Sequence:CCGGGCCGCACCATGCCGCTTCTTACTCGAGTAAGAAGCGGCATGGTGCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315525    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008753.4-260s21c1
Sequence:CCGGTGCCCTTAATTGCTGTAGTAACTCGAGTTACTACAGCAATTAAGGGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315526    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008753.4-840s21c1
Sequence:CCGGGTCGTGATTGTGCAGAATAAACTCGAGTTTATTCTGCACAATCACGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309063    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008753.4-240s21c1
Sequence:CCGGAGCAGCGAGAGTTCTAGGGTTCTCGAGAACCCTAGAACTCTCGCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099628    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008753.3-196s1c1
Sequence:CCGGGCCGCACCATGCCGCTTCTTACTCGAGTAAGAAGCGGCATGGTGCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099629    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008753.3-240s1c1
Sequence:CCGGAGCAGCGAGAGTTCTAGGGTTCTCGAGAACCCTAGAACTCTCGCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099627    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008753.3-260s1c1
Sequence:CCGGTGCCCTTAATTGCTGTAGTAACTCGAGTTACTACAGCAATTAAGGGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099625    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 1.0 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008753.3-840s1c1
Sequence:CCGGGTCGTGATTGTGCAGAATAAACTCGAGTTTATTCTGCACAATCACGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004152
VALIDATED
OAZ1 MISSION shRNA Bacterial Glycerol Stock
ornithine decarboxylase antizyme 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000298228    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004152.2-234s21c1
Sequence:CCGGCTCCCTCCACTGCTGTAGTAACTCGAGTTACTACAGCAGTGGAGGGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286513    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004152.2-170s21c1
Sequence:CCGGGCCGCACCATGCCGCTCCTAACTCGAGTTAGGAGCGGCATGGTGCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286446    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004152.2-114s21c1
Sequence:CCGGCCACTGCTTCGCCAGAGAGAACTCGAGTTCTCTCTGGCGAAGCAGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293882    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_004152.2-342s21c1
Sequence:CCGGACAATCTTTCAGCTAACTTATCTCGAGATAAGTTAGCTGAAAGATTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298606    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_004152.2-865s21c1
Sequence:CCGGATGTTGTAATCGTGCAAATAACTCGAGTTATTTGCACGATTACAACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078493    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_004152.2-903s1c1
Sequence:CCGGGCGGTGTATTTCTTGAAGTTTCTCGAGAAACTTCAAGAAATACACCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078496    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_004152.2-170s1c1
Sequence:CCGGGCCGCACCATGCCGCTCCTAACTCGAGTTAGGAGCGGCATGGTGCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078497    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_004152.2-234s1c1
Sequence:CCGGCTCCCTCCACTGCTGTAGTAACTCGAGTTACTACAGCAGTGGAGGGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078495    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_004152.2-114s1c1
Sequence:CCGGCCACTGCTTCGCCAGAGAGAACTCGAGTTCTCTCTGGCGAAGCAGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078494    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004152.2-241s1c1
Sequence:CCGGCACTGCTGTAGTAACCCGGGTCTCGAGACCCGGGTTACTACAGCAGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004152
VALIDATED
OAZ1 MISSION shRNA shRNA Plasmid DNA
ornithine decarboxylase antizyme 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000298228    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004152.2-234s21c1
Sequence:CCGGCTCCCTCCACTGCTGTAGTAACTCGAGTTACTACAGCAGTGGAGGGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000286513    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004152.2-170s21c1
Sequence:CCGGGCCGCACCATGCCGCTCCTAACTCGAGTTAGGAGCGGCATGGTGCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000286446    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004152.2-114s21c1
Sequence:CCGGCCACTGCTTCGCCAGAGAGAACTCGAGTTCTCTCTGGCGAAGCAGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000293882    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_004152.2-342s21c1
Sequence:CCGGACAATCTTTCAGCTAACTTATCTCGAGATAAGTTAGCTGAAAGATTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000298606    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_004152.2-865s21c1
Sequence:CCGGATGTTGTAATCGTGCAAATAACTCGAGTTATTTGCACGATTACAACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078493    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_004152.2-903s1c1
Sequence:CCGGGCGGTGTATTTCTTGAAGTTTCTCGAGAAACTTCAAGAAATACACCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078496    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_004152.2-170s1c1
Sequence:CCGGGCCGCACCATGCCGCTCCTAACTCGAGTTAGGAGCGGCATGGTGCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078497    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_004152.2-234s1c1
Sequence:CCGGCTCCCTCCACTGCTGTAGTAACTCGAGTTACTACAGCAGTGGAGGGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078495    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_004152.2-114s1c1
Sequence:CCGGCCACTGCTTCGCCAGAGAGAACTCGAGTTCTCTCTGGCGAAGCAGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078494    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004152.2-241s1c1
Sequence:CCGGCACTGCTGTAGTAACCCGGGTCTCGAGACCCGGGTTACTACAGCAGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004152
VALIDATED
OAZ1 MISSION shRNA Lentiviral Transduction Particles
ornithine decarboxylase antizyme 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000298228    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004152.2-234s21c1
Sequence:CCGGCTCCCTCCACTGCTGTAGTAACTCGAGTTACTACAGCAGTGGAGGGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286513    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004152.2-170s21c1
Sequence:CCGGGCCGCACCATGCCGCTCCTAACTCGAGTTAGGAGCGGCATGGTGCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286446    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004152.2-114s21c1
Sequence:CCGGCCACTGCTTCGCCAGAGAGAACTCGAGTTCTCTCTGGCGAAGCAGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293882    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_004152.2-342s21c1
Sequence:CCGGACAATCTTTCAGCTAACTTATCTCGAGATAAGTTAGCTGAAAGATTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298606    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_004152.2-865s21c1
Sequence:CCGGATGTTGTAATCGTGCAAATAACTCGAGTTATTTGCACGATTACAACATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078493    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_004152.2-903s1c1
Sequence:CCGGGCGGTGTATTTCTTGAAGTTTCTCGAGAAACTTCAAGAAATACACCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078496    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_004152.2-170s1c1
Sequence:CCGGGCCGCACCATGCCGCTCCTAACTCGAGTTAGGAGCGGCATGGTGCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078497    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_004152.2-234s1c1
Sequence:CCGGCTCCCTCCACTGCTGTAGTAACTCGAGTTACTACAGCAGTGGAGGGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078495    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_004152.2-114s1c1
Sequence:CCGGCCACTGCTTCGCCAGAGAGAACTCGAGTTCTCTCTGGCGAAGCAGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078494    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004152.2-241s1c1
Sequence:CCGGCACTGCTGTAGTAACCCGGGTCTCGAGACCCGGGTTACTACAGCAGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)