EMAIL THIS PAGE TO A FRIEND

OAZ2

ornithine decarboxylase antizyme 2

187 Gene Product Result for
Synonyms: AZ2
UniProtKB ID: O95190
Gene ID:
Human(4947) Summary: Ornithine decarboxylase catalyzes the conversion of ornithine to putrescine in the first and apparently rate-limiting step in polyamine biosynthesis. The ornithine decarboxylase antizymes play a role in the regulation of polyamine synthesis by binding to and inhibiting ornithine decarboxylase. Antizyme expression is auto-regulated by polyamine-enhanced translational frameshifting. The antizyme encoded by this gene inhibits ornithine decarboxylase but does not accelerate its degradation. [provided by RefSeq, Jul 2008]
Mouse(18247) ornithine decarboxylase antizyme 2
Rat(501454) ornithine decarboxylase antizyme 2
chicken(427481) ornithine decarboxylase antizyme 2
domestic cat(101086568) ornithine decarboxylase antizyme 2
Horse(100066770) ornithine decarboxylase antizyme 2
cow(524677) ornithine decarboxylase antizyme 2
dog(478343) ornithine decarboxylase antizyme 2
sheep(101107870) ornithine decarboxylase antizyme 2
domestic guinea pig(100727467) ornithine decarboxylase antizyme 2
naked mole-rat(101701408) ornithine decarboxylase antizyme 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002537 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002537 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002537 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010952 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010952 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010952 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002537 Rosetta Predictions human pricing
NM_001109899 Rosetta Predictions rat pricing
XM_576864 Rosetta Predictions rat pricing
XR_009104 Rosetta Predictions rat pricing
NM_010952 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002537 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00196641 predicted 1664
2 SASI_Hs01_00196642 predicted 1181
3 SASI_Hs01_00196643 predicted 723
4 SASI_Hs02_00334024 predicted 1592
5 SASI_Hs01_00196644 predicted 1437
6 SASI_Hs02_00334025 predicted 517
7 SASI_Hs01_00196645 predicted 907
8 SASI_Hs01_00196646 predicted 1364
9 SASI_Hs01_00196647 predicted 556
10 SASI_Hs01_00196649 predicted 565
11 SASI_Hs01_00196648 predicted 1343
12 SASI_Hs01_00196650 predicted 587
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109899 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00250812 predicted 673
2 SASI_Rn02_00250813 predicted 391
3 SASI_Rn02_00250814 predicted 1423
4 SASI_Rn02_00250815 predicted 722
5 SASI_Rn02_00250816 predicted 1311
6 SASI_Rn02_00250817 predicted 863
7 SASI_Rn02_00250818 predicted 996
8 SASI_Rn02_00250819 predicted 506
9 SASI_Rn02_00250820 predicted 1306
10 SASI_Rn02_00250821 predicted 638
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_576864 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00194877 predicted 889
2 SASI_Rn01_00194878 predicted 290
3 SASI_Rn01_00194879 predicted 893
4 SASI_Rn01_00194880 predicted 608
5 SASI_Rn01_00194881 predicted 245
6 SASI_Rn01_00194882 predicted 612
7 SASI_Rn01_00194883 predicted 679
8 SASI_Rn01_00194884 predicted 944
9 SASI_Rn01_00194885 predicted 813
10 SASI_Rn01_00194886 predicted 737
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_009104 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00169973 predicted 917
2 SASI_Rn01_00169974 predicted 716
3 SASI_Rn01_00169975 predicted 1468
4 SASI_Rn01_00169976 predicted 764
5 SASI_Rn01_00169977 predicted 1352
6 SASI_Rn01_00169978 predicted 903
7 SASI_Rn01_00169979 predicted 1037
8 SASI_Rn01_00169980 predicted 546
9 SASI_Rn01_00169981 predicted 1343
10 SASI_Rn01_00169982 predicted 680
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010952 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00122690 predicted 1215
2 SASI_Mm01_00122683 predicted 712
3 SASI_Mm01_00122684 predicted 421
4 SASI_Mm01_00122686 predicted 754
5 SASI_Mm01_00122687 predicted 494
6 SASI_Mm01_00122685 predicted 1449
7 SASI_Mm01_00122688 predicted 890
8 SASI_Mm01_00122689 predicted 536
9 SASI_Mm01_00122691 predicted 1336
10 SASI_Mm01_00122692 predicted 744
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002537
VALIDATED
OAZ2 MISSION shRNA Bacterial Glycerol Stock
ornithine decarboxylase antizyme 2
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000078501    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002537.1-258s1c1
Sequence:CCGGGCTCCAGTGCTGCAGGCACATCTCGAGATGTGCCTGCAGCACTGGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303510    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_002537.2-733s21c1
Sequence:CCGGGATGTGATGTTCATGGTTTATCTCGAGATAAACCATGAACATCACATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078500    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002537.1-273s1c1
Sequence:CCGGGCACATTGTTCCAGGGCCTCTCTCGAGAGAGGCCCTGGAACAATGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078498    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002537.1-1386s1c1
Sequence:CCGGGCTGGCTTAATCTTGTTTAATCTCGAGATTAAACAAGATTAAGCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078499    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002537.1-262s1c1
Sequence:CCGGCAGTGCTGCAGGCACATTGTTCTCGAGAACAATGTGCCTGCAGCACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078502    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002537.1-271s1c1
Sequence:CCGGAGGCACATTGTTCCAGGGCCTCTCGAGAGGCCCTGGAACAATGTGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315770    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002537.2-279s21c1
Sequence:CCGGAGGCACATTGTTCCAGGGCCTCTCGAGAGGCCCTGGAACAATGTGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303615    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_002537.2-926s21c1
Sequence:CCGGTCGGAGTTGACTCGTTGAAATCTCGAGATTTCAACGAGTCAACTCCGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303511    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_002537.2-769s21c1
Sequence:CCGGTTGTCCGATGAGGACTAATAGCTCGAGCTATTAGTCCTCATCGGACAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002537
VALIDATED
OAZ2 MISSION shRNA shRNA Plasmid DNA
ornithine decarboxylase antizyme 2
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000078501    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002537.1-258s1c1
Sequence:CCGGGCTCCAGTGCTGCAGGCACATCTCGAGATGTGCCTGCAGCACTGGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000303510    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_002537.2-733s21c1
Sequence:CCGGGATGTGATGTTCATGGTTTATCTCGAGATAAACCATGAACATCACATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078500    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002537.1-273s1c1
Sequence:CCGGGCACATTGTTCCAGGGCCTCTCTCGAGAGAGGCCCTGGAACAATGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078498    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002537.1-1386s1c1
Sequence:CCGGGCTGGCTTAATCTTGTTTAATCTCGAGATTAAACAAGATTAAGCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078499    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002537.1-262s1c1
Sequence:CCGGCAGTGCTGCAGGCACATTGTTCTCGAGAACAATGTGCCTGCAGCACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078502    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002537.1-271s1c1
Sequence:CCGGAGGCACATTGTTCCAGGGCCTCTCGAGAGGCCCTGGAACAATGTGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000315770    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002537.2-279s21c1
Sequence:CCGGAGGCACATTGTTCCAGGGCCTCTCGAGAGGCCCTGGAACAATGTGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000303615    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_002537.2-926s21c1
Sequence:CCGGTCGGAGTTGACTCGTTGAAATCTCGAGATTTCAACGAGTCAACTCCGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000303511    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_002537.2-769s21c1
Sequence:CCGGTTGTCCGATGAGGACTAATAGCTCGAGCTATTAGTCCTCATCGGACAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002537
VALIDATED
OAZ2 MISSION shRNA Lentiviral Transduction Particles
ornithine decarboxylase antizyme 2
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000078501    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002537.1-258s1c1
Sequence:CCGGGCTCCAGTGCTGCAGGCACATCTCGAGATGTGCCTGCAGCACTGGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303510    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_002537.2-733s21c1
Sequence:CCGGGATGTGATGTTCATGGTTTATCTCGAGATAAACCATGAACATCACATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078500    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002537.1-273s1c1
Sequence:CCGGGCACATTGTTCCAGGGCCTCTCTCGAGAGAGGCCCTGGAACAATGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078498    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002537.1-1386s1c1
Sequence:CCGGGCTGGCTTAATCTTGTTTAATCTCGAGATTAAACAAGATTAAGCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078499    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002537.1-262s1c1
Sequence:CCGGCAGTGCTGCAGGCACATTGTTCTCGAGAACAATGTGCCTGCAGCACTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078502    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002537.1-271s1c1
Sequence:CCGGAGGCACATTGTTCCAGGGCCTCTCGAGAGGCCCTGGAACAATGTGCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315770    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002537.2-279s21c1
Sequence:CCGGAGGCACATTGTTCCAGGGCCTCTCGAGAGGCCCTGGAACAATGTGCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303615    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_002537.2-926s21c1
Sequence:CCGGTCGGAGTTGACTCGTTGAAATCTCGAGATTTCAACGAGTCAACTCCGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303511    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_002537.2-769s21c1
Sequence:CCGGTTGTCCGATGAGGACTAATAGCTCGAGCTATTAGTCCTCATCGGACAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010952
OAZ2 MISSION shRNA Bacterial Glycerol Stock
ornithine decarboxylase antizyme 2
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000184195    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010952.2-1601s1c1
Sequence:CCGGGCCTCCTTAACAGGTTCAGAACTCGAGTTCTGAACCTGTTAAGGAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217287    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010952.3-539s1c1
Sequence:CCGGGGGAGCAAAGAAGGATTATTACTCGAGTAATAATCCTTCTTTGCTCCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000258047    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010952.3-909s21c1
Sequence:CCGGTCGGAGTTGACTCGTTGAAATCTCGAGATTTCAACGAGTCAACTCCGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250381    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010952.3-709s21c1
Sequence:CCGGTCGGCCAGATGTGATGTTTATCTCGAGATAAACATCACATCTGGCCGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216078    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010952.3-351s1c1
Sequence:CCGGCTTCTCTCTCAGCTCTAATATCTCGAGATATTAGAGCTGAGAGAGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180584    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010952.2-1504s1c1
Sequence:CCGGGCAGAGAGGAAGAATACCAAACTCGAGTTTGGTATTCTTCCTCTCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179833    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010952.2-669s1c1
Sequence:CCGGCCAGATGTGATGTTTATGGTTCTCGAGAACCATAAACATCACATCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215625    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010952.3-512s1c1
Sequence:CCGGGAAATCCCAGATGGATTATTACTCGAGTAATAATCCATCTGGGATTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250382    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010952.3-751s21c1
Sequence:CCGGCTTGTCTGATGAGGACTAATGCTCGAGCATTAGTCCTCATCAGACAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250380    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010952.3-539s21c1
Sequence:CCGGGGGAGCAAAGAAGGATTATTACTCGAGTAATAATCCTTCTTTGCTCCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000258046    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010952.3-351s21c1
Sequence:CCGGCTTCTCTCTCAGCTCTAATATCTCGAGATATTAGAGCTGAGAGAGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010952
OAZ2 MISSION shRNA shRNA Plasmid DNA
ornithine decarboxylase antizyme 2
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000184195    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010952.2-1601s1c1
Sequence:CCGGGCCTCCTTAACAGGTTCAGAACTCGAGTTCTGAACCTGTTAAGGAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000217287    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010952.3-539s1c1
Sequence:CCGGGGGAGCAAAGAAGGATTATTACTCGAGTAATAATCCTTCTTTGCTCCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000258047    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010952.3-909s21c1
Sequence:CCGGTCGGAGTTGACTCGTTGAAATCTCGAGATTTCAACGAGTCAACTCCGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250381    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010952.3-709s21c1
Sequence:CCGGTCGGCCAGATGTGATGTTTATCTCGAGATAAACATCACATCTGGCCGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000216078    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010952.3-351s1c1
Sequence:CCGGCTTCTCTCTCAGCTCTAATATCTCGAGATATTAGAGCTGAGAGAGAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000180584    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010952.2-1504s1c1
Sequence:CCGGGCAGAGAGGAAGAATACCAAACTCGAGTTTGGTATTCTTCCTCTCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000179833    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010952.2-669s1c1
Sequence:CCGGCCAGATGTGATGTTTATGGTTCTCGAGAACCATAAACATCACATCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000215625    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010952.3-512s1c1
Sequence:CCGGGAAATCCCAGATGGATTATTACTCGAGTAATAATCCATCTGGGATTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250382    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010952.3-751s21c1
Sequence:CCGGCTTGTCTGATGAGGACTAATGCTCGAGCATTAGTCCTCATCAGACAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250380    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010952.3-539s21c1
Sequence:CCGGGGGAGCAAAGAAGGATTATTACTCGAGTAATAATCCTTCTTTGCTCCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000258046    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010952.3-351s21c1
Sequence:CCGGCTTCTCTCTCAGCTCTAATATCTCGAGATATTAGAGCTGAGAGAGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010952
OAZ2 MISSION shRNA Lentiviral Transduction Particles
ornithine decarboxylase antizyme 2
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000184195    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010952.2-1601s1c1
Sequence:CCGGGCCTCCTTAACAGGTTCAGAACTCGAGTTCTGAACCTGTTAAGGAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217287    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010952.3-539s1c1
Sequence:CCGGGGGAGCAAAGAAGGATTATTACTCGAGTAATAATCCTTCTTTGCTCCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000258047    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010952.3-909s21c1
Sequence:CCGGTCGGAGTTGACTCGTTGAAATCTCGAGATTTCAACGAGTCAACTCCGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250381    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010952.3-709s21c1
Sequence:CCGGTCGGCCAGATGTGATGTTTATCTCGAGATAAACATCACATCTGGCCGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216078    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010952.3-351s1c1
Sequence:CCGGCTTCTCTCTCAGCTCTAATATCTCGAGATATTAGAGCTGAGAGAGAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180584    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010952.2-1504s1c1
Sequence:CCGGGCAGAGAGGAAGAATACCAAACTCGAGTTTGGTATTCTTCCTCTCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179833    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010952.2-669s1c1
Sequence:CCGGCCAGATGTGATGTTTATGGTTCTCGAGAACCATAAACATCACATCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215625    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010952.3-512s1c1
Sequence:CCGGGAAATCCCAGATGGATTATTACTCGAGTAATAATCCATCTGGGATTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250382    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010952.3-751s21c1
Sequence:CCGGCTTGTCTGATGAGGACTAATGCTCGAGCATTAGTCCTCATCAGACAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250380    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010952.3-539s21c1
Sequence:CCGGGGGAGCAAAGAAGGATTATTACTCGAGTAATAATCCTTCTTTGCTCCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000258046    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010952.3-351s21c1
Sequence:CCGGCTTCTCTCTCAGCTCTAATATCTCGAGATATTAGAGCTGAGAGAGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)