EMAIL THIS PAGE TO A FRIEND

OBP2A

odorant binding protein 2A

39 Gene Product Result for
Synonyms: OBP OBP2C OBPIIa hOBPIIa
UniProtKB ID: Q9NY56, Q5T8A3, Q9NY50, Q9NY53, Q9NY54, Q9NY55
Gene ID:
Human(29991) Summary: This gene encodes a small extracellular protein belonging to the lipocalin superfamily. The protein is thought to transport small, hydrophobic, volatile molecules or odorants through the nasal mucus to olfactory receptors, and may also function as a scavenger of highly concentrated or toxic odors. The protein is expressed as a monomer in the nasal mucus, and can bind diverse types of odorants with a higher affinity for aldehydes and fatty acids. This gene and a highly similar family member are located in a cluster of lipocalin genes on chromosome 9. Alternatively spliced transcript variants have been described, but their biological validity has not been determined. [provided by RefSeq, Jul 2008]
Mouse(227627) odorant binding protein 2A
Rat(680754) odorant binding protein 2A
naked mole-rat(101726151) odorant binding protein 2A
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014582 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014582 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014582 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_153558 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_153558 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_153558 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014582 Rosetta Predictions human pricing
NM_001128139 Rosetta Predictions rat pricing
NM_153558 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014582 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00226829 predicted 394
2 SASI_Hs01_00226830 predicted 415
3 SASI_Hs01_00226831 predicted 407
4 SASI_Hs01_00226832 predicted 421
5 SASI_Hs01_00226833 predicted 426
6 SASI_Hs01_00226834 predicted 353
7 SASI_Hs01_00226835 predicted 355
8 SASI_Hs01_00226836 predicted 358
9 SASI_Hs01_00226837 predicted 347
10 SASI_Hs01_00226838 predicted 352
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001128139 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00254990 predicted 372
2 SASI_Rn02_00254991 predicted 269
3 SASI_Rn02_00254992 predicted 432
4 SASI_Rn02_00254993 predicted 225
5 SASI_Rn02_00254994 predicted 195
6 SASI_Rn02_00254995 predicted 205
7 SASI_Rn02_00254996 predicted 207
8 SASI_Rn02_00254997 predicted 301
9 SASI_Rn02_00254998 predicted 284
10 SASI_Rn02_00254999 predicted 287
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153558 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00164935 predicted 284
2 SASI_Mm01_00164936 predicted 378
3 SASI_Mm01_00164937 predicted 251
4 SASI_Mm01_00164938 predicted 312
5 SASI_Mm01_00164939 predicted 317
6 SASI_Mm01_00164940 predicted 238
7 SASI_Mm01_00164941 predicted 339
8 SASI_Mm01_00164942 predicted 223
9 SASI_Mm01_00164943 predicted 248
10 SASI_Mm01_00164944 predicted 476
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014582
OBP2A MISSION shRNA Bacterial Glycerol Stock
odorant binding protein 2A
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000059729    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014582.1-435s1c1
Sequence:CCGGGAATCCTAATACCAACCTGGACTCGAGTCCAGGTTGGTATTAGGATTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059732    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014582.1-256s1c1
Sequence:CCGGGATCGGTGCATCCAGAAGAAACTCGAGTTTCTTCTGGATGCACCGATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059728    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014582.1-458s1c1
Sequence:CCGGCCCTGGAAGAATTTAAGAAATCTCGAGATTTCTTAAATTCTTCCAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059731    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014582.1-423s1c1
Sequence:CCGGGCTTGTGGGTAGGAATCCTAACTCGAGTTAGGATTCCTACCCACAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059730    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014582.1-301s1c1
Sequence:CCGGCCTGGCAAATTCAGCGCCTATCTCGAGATAGGCGCTGAATTTGCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378935    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014582.2-143s21c1
Sequence:CCGGTGGTGGTCGATAAGGACTTTCCTCGAGGAAAGTCCTTATCGACCACCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378859    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014582.2-101s21c1
Sequence:CCGGTGGAGGAGGAGGATATCACAGCTCGAGCTGTGATATCCTCCTCCTCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378861    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014582.2-222s21c1
Sequence:CCGGGAACTTGGAAGCCACGTTCACCTCGAGGTGAACGTGGCTTCCAAGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014582
OBP2A MISSION shRNA shRNA Plasmid DNA
odorant binding protein 2A
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000059729    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014582.1-435s1c1
Sequence:CCGGGAATCCTAATACCAACCTGGACTCGAGTCCAGGTTGGTATTAGGATTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059732    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014582.1-256s1c1
Sequence:CCGGGATCGGTGCATCCAGAAGAAACTCGAGTTTCTTCTGGATGCACCGATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059728    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014582.1-458s1c1
Sequence:CCGGCCCTGGAAGAATTTAAGAAATCTCGAGATTTCTTAAATTCTTCCAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059731    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014582.1-423s1c1
Sequence:CCGGGCTTGTGGGTAGGAATCCTAACTCGAGTTAGGATTCCTACCCACAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059730    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014582.1-301s1c1
Sequence:CCGGCCTGGCAAATTCAGCGCCTATCTCGAGATAGGCGCTGAATTTGCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000378935    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014582.2-143s21c1
Sequence:CCGGTGGTGGTCGATAAGGACTTTCCTCGAGGAAAGTCCTTATCGACCACCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000378859    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014582.2-101s21c1
Sequence:CCGGTGGAGGAGGAGGATATCACAGCTCGAGCTGTGATATCCTCCTCCTCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000378861    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014582.2-222s21c1
Sequence:CCGGGAACTTGGAAGCCACGTTCACCTCGAGGTGAACGTGGCTTCCAAGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014582
OBP2A MISSION shRNA Lentiviral Transduction Particles
odorant binding protein 2A
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000059729    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014582.1-435s1c1
Sequence:CCGGGAATCCTAATACCAACCTGGACTCGAGTCCAGGTTGGTATTAGGATTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059732    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014582.1-256s1c1
Sequence:CCGGGATCGGTGCATCCAGAAGAAACTCGAGTTTCTTCTGGATGCACCGATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059728    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014582.1-458s1c1
Sequence:CCGGCCCTGGAAGAATTTAAGAAATCTCGAGATTTCTTAAATTCTTCCAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059731    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014582.1-423s1c1
Sequence:CCGGGCTTGTGGGTAGGAATCCTAACTCGAGTTAGGATTCCTACCCACAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059730    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014582.1-301s1c1
Sequence:CCGGCCTGGCAAATTCAGCGCCTATCTCGAGATAGGCGCTGAATTTGCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378935    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014582.2-143s21c1
Sequence:CCGGTGGTGGTCGATAAGGACTTTCCTCGAGGAAAGTCCTTATCGACCACCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378859    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014582.2-101s21c1
Sequence:CCGGTGGAGGAGGAGGATATCACAGCTCGAGCTGTGATATCCTCCTCCTCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378861    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014582.2-222s21c1
Sequence:CCGGGAACTTGGAAGCCACGTTCACCTCGAGGTGAACGTGGCTTCCAAGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153558
OBP2A MISSION shRNA Bacterial Glycerol Stock
odorant binding protein 2A
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000105439    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153558.1-156s1c1
Sequence:CCGGAGTCACAAGATACCCAGTATACTCGAGTATACTGGGTATCTTGTGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105435    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153558.1-319s1c1
Sequence:CCGGCGAAGGTTATTCATGTGGAAACTCGAGTTTCCACATGAATAACCTTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105438    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153558.1-481s1c1
Sequence:CCGGGCATGAATCTCCGACTGGAAACTCGAGTTTCCAGTCGGAGATTCATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105437    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153558.1-223s1c1
Sequence:CCGGCCACAGTTGTATTCTGGAACACTCGAGTGTTCCAGAATACAACTGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105436    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153558.1-254s1c1
Sequence:CCGGCCGTGAGTTTAAATTCGTGATCTCGAGATCACGAATTTAAACTCACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153558
OBP2A MISSION shRNA shRNA Plasmid DNA
odorant binding protein 2A
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000105439    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153558.1-156s1c1
Sequence:CCGGAGTCACAAGATACCCAGTATACTCGAGTATACTGGGTATCTTGTGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000105435    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153558.1-319s1c1
Sequence:CCGGCGAAGGTTATTCATGTGGAAACTCGAGTTTCCACATGAATAACCTTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000105438    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153558.1-481s1c1
Sequence:CCGGGCATGAATCTCCGACTGGAAACTCGAGTTTCCAGTCGGAGATTCATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000105437    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153558.1-223s1c1
Sequence:CCGGCCACAGTTGTATTCTGGAACACTCGAGTGTTCCAGAATACAACTGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000105436    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153558.1-254s1c1
Sequence:CCGGCCGTGAGTTTAAATTCGTGATCTCGAGATCACGAATTTAAACTCACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153558
OBP2A MISSION shRNA Lentiviral Transduction Particles
odorant binding protein 2A
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000105439    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153558.1-156s1c1
Sequence:CCGGAGTCACAAGATACCCAGTATACTCGAGTATACTGGGTATCTTGTGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105435    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153558.1-319s1c1
Sequence:CCGGCGAAGGTTATTCATGTGGAAACTCGAGTTTCCACATGAATAACCTTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105438    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153558.1-481s1c1
Sequence:CCGGGCATGAATCTCCGACTGGAAACTCGAGTTTCCAGTCGGAGATTCATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105437    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153558.1-223s1c1
Sequence:CCGGCCACAGTTGTATTCTGGAACACTCGAGTGTTCCAGAATACAACTGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105436    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153558.1-254s1c1
Sequence:CCGGCCGTGAGTTTAAATTCGTGATCTCGAGATCACGAATTTAAACTCACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)