EMAIL THIS PAGE TO A FRIEND

OBP2B

odorant binding protein 2B

34 Gene Product Result for
Synonyms: hOBPIIb
UniProtKB ID: Q9NPH6, Q5VSP6, Q9NY51, Q9NY52
Gene ID:
Mouse(383678) odorant binding protein 2B
Rat(286933) odorant binding protein 2B
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001099301 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001099301 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001099301 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_014581 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014581 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014581 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014581 Rosetta Predictions human pricing
NM_173148 Rosetta Predictions rat pricing
NM_001099301 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014581 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00126928 predicted 395
2 SASI_Hs01_00126929 predicted 426
3 SASI_Hs01_00126930 predicted 401
4 SASI_Hs01_00126931 predicted 350
5 SASI_Hs01_00126932 predicted 419
6 SASI_Hs01_00126933 predicted 425
7 SASI_Hs01_00126934 predicted 344
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173148 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00108492 predicted 385
2 SASI_Rn01_00108493 predicted 287
3 SASI_Rn02_00269335 predicted 205
4 SASI_Rn01_00108494 predicted 236
5 SASI_Rn01_00108495 predicted 342
6 SASI_Rn01_00108496 predicted 412
7 SASI_Rn01_00108497 predicted 374
8 SASI_Rn01_00108498 predicted 320
9 SASI_Rn01_00108499 predicted 345
10 SASI_Rn01_00108500 predicted 313
11 SASI_Rn01_00108501 predicted 352
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001099301 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00301601 predicted 213
2 SASI_Mm02_00301602 predicted 337
3 SASI_Mm02_00301603 predicted 415
4 SASI_Mm02_00301604 predicted 251
5 SASI_Mm02_00301605 predicted 267
6 SASI_Mm02_00301606 predicted 379
7 SASI_Mm02_00301607 predicted 255
8 SASI_Mm02_00301608 predicted 357
9 SASI_Mm02_00301609 predicted 322
10 SASI_Mm02_00301610 predicted 479
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001099301
OBP2B MISSION shRNA Bacterial Glycerol Stock
odorant binding protein 2B
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000270136    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099301.1-556s21c1
Sequence:CCGGCAGTGTGTGTCTGGGAGTAACCTCGAGGTTACTCCCAGACACACACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000270138    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099301.1-247s21c1
Sequence:CCGGTTAGAGGCCCAGCTAACATTCCTCGAGGAATGTTAGCTGGGCCTCTAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000270139    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099301.1-209s21c1
Sequence:CCGGTGTTCCCTATGACCGTGATAGCTCGAGCTATCACGGTCATAGGGAACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000270073    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099301.1-383s21c1
Sequence:CCGGAGGGCTACTACATCTTGTATTCTCGAGAATACAAGATGTAGTAGCCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000270137    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099301.1-344s21c1
Sequence:CCGGAGGGCAAGAAGACCATCTATACTCGAGTATAGATGGTCTTCTTGCCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001099301
OBP2B MISSION shRNA shRNA Plasmid DNA
odorant binding protein 2B
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000270136    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099301.1-556s21c1
Sequence:CCGGCAGTGTGTGTCTGGGAGTAACCTCGAGGTTACTCCCAGACACACACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000270138    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099301.1-247s21c1
Sequence:CCGGTTAGAGGCCCAGCTAACATTCCTCGAGGAATGTTAGCTGGGCCTCTAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000270139    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099301.1-209s21c1
Sequence:CCGGTGTTCCCTATGACCGTGATAGCTCGAGCTATCACGGTCATAGGGAACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000270073    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099301.1-383s21c1
Sequence:CCGGAGGGCTACTACATCTTGTATTCTCGAGAATACAAGATGTAGTAGCCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000270137    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099301.1-344s21c1
Sequence:CCGGAGGGCAAGAAGACCATCTATACTCGAGTATAGATGGTCTTCTTGCCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001099301
OBP2B MISSION shRNA Lentiviral Transduction Particles
odorant binding protein 2B
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000270136    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099301.1-556s21c1
Sequence:CCGGCAGTGTGTGTCTGGGAGTAACCTCGAGGTTACTCCCAGACACACACTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000270138    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099301.1-247s21c1
Sequence:CCGGTTAGAGGCCCAGCTAACATTCCTCGAGGAATGTTAGCTGGGCCTCTAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000270139    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099301.1-209s21c1
Sequence:CCGGTGTTCCCTATGACCGTGATAGCTCGAGCTATCACGGTCATAGGGAACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000270073    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099301.1-383s21c1
Sequence:CCGGAGGGCTACTACATCTTGTATTCTCGAGAATACAAGATGTAGTAGCCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000270137    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099301.1-344s21c1
Sequence:CCGGAGGGCAAGAAGACCATCTATACTCGAGTATAGATGGTCTTCTTGCCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014581
OBP2B MISSION shRNA Bacterial Glycerol Stock
odorant binding protein 2B
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000250153    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014581.2-494s21c1
Sequence:CCGGGACTCTCGGAGGAGGACATTTCTCGAGAAATGTCCTCCTCCGAGAGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250150    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014581.2-453s21c1
Sequence:CCGGGGAGGCCCTGGAAGAATTTAACTCGAGTTAAATTCTTCCAGGGCCTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250152    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014581.2-135s21c1
Sequence:CCGGGAAGGCCATGGTGGTCGATAACTCGAGTTATCGACCACCATGGCCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000258007    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014581.2-409s21c1
Sequence:CCGGCTCCACATGGGAAAGCTTGTGCTCGAGCACAAGCTTTCCCATGTGGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250151    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014581.2-302s21c1
Sequence:CCGGCTGGCAAATACAGCGCCTATGCTCGAGCATAGGCGCTGTATTTGCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014581
OBP2B MISSION shRNA shRNA Plasmid DNA
odorant binding protein 2B
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000250153    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014581.2-494s21c1
Sequence:CCGGGACTCTCGGAGGAGGACATTTCTCGAGAAATGTCCTCCTCCGAGAGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250150    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014581.2-453s21c1
Sequence:CCGGGGAGGCCCTGGAAGAATTTAACTCGAGTTAAATTCTTCCAGGGCCTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250152    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014581.2-135s21c1
Sequence:CCGGGAAGGCCATGGTGGTCGATAACTCGAGTTATCGACCACCATGGCCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000258007    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014581.2-409s21c1
Sequence:CCGGCTCCACATGGGAAAGCTTGTGCTCGAGCACAAGCTTTCCCATGTGGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250151    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014581.2-302s21c1
Sequence:CCGGCTGGCAAATACAGCGCCTATGCTCGAGCATAGGCGCTGTATTTGCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014581
OBP2B MISSION shRNA Lentiviral Transduction Particles
odorant binding protein 2B
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000250153    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014581.2-494s21c1
Sequence:CCGGGACTCTCGGAGGAGGACATTTCTCGAGAAATGTCCTCCTCCGAGAGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250150    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014581.2-453s21c1
Sequence:CCGGGGAGGCCCTGGAAGAATTTAACTCGAGTTAAATTCTTCCAGGGCCTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250152    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014581.2-135s21c1
Sequence:CCGGGAAGGCCATGGTGGTCGATAACTCGAGTTATCGACCACCATGGCCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000258007    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014581.2-409s21c1
Sequence:CCGGCTCCACATGGGAAAGCTTGTGCTCGAGCACAAGCTTTCCCATGTGGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250151    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014581.2-302s21c1
Sequence:CCGGCTGGCAAATACAGCGCCTATGCTCGAGCATAGGCGCTGTATTTGCCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)