EMAIL THIS PAGE TO A FRIEND

OBSCN

obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF

81 Gene Product Result for
Synonyms: ARHGEF30 UNC89
Gene ID:
Human(84033) Summary: The obscurin gene spans more than 150 kb, contains over 80 exons and encodes a protein of approximately 720 kDa. The encoded protein contains 68 Ig domains, 2 fibronectin domains, 1 calcium/calmodulin-binding domain, 1 RhoGEF domain with an associated PH domain, and 2 serine-threonine kinase domains. This protein belongs to the family of giant sacromeric signaling proteins that includes titin and nebulin, and may have a role in the organization of myofibrils during assembly and may mediate interactions between the sarcoplasmic reticulum and myofibrils. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
Mouse(380698) obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF
Rat(338458) obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF
Zebrafish(445358) obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF
domestic cat(101101539) obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF
cow(537193) obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF
dog(482206) obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF
chicken(420395) obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF
sheep(101121853) obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF
domestic guinea pig(100727808) obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF
naked mole-rat(101701039) obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001003914 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001003914 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001003914 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_052843 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_052843 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_052843 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001098623 Rosetta Predictions human pricing
NM_052843 Rosetta Predictions human pricing
XM_001076876 Rosetta Predictions rat pricing
XM_340807 Rosetta Predictions rat pricing
NM_001003914 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001098623 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00319536 predicted 7968
2 SASI_Hs02_00319537 predicted 15709
3 SASI_Hs02_00319538 predicted 16027
4 SASI_Hs02_00319539 predicted 5239
5 SASI_Hs02_00319540 predicted 12028
6 SASI_Hs02_00319541 predicted 14696
7 SASI_Hs02_00319542 predicted 1164
8 SASI_Hs02_00319543 predicted 12570
9 SASI_Hs02_00319544 predicted 3938
10 SASI_Hs02_00319545 predicted 10800
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_052843 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00361522 predicted 7969
2 SASI_Hs01_00085034 predicted 15706
3 SASI_Hs01_00085035 predicted 16024
4 SASI_Hs01_00085036 predicted 5241
5 SASI_Hs01_00085039 predicted 12024
6 SASI_Hs01_00085040 predicted 14696
7 SASI_Hs02_00361523 predicted 1169
8 SASI_Hs01_00085041 predicted 12569
9 SASI_Hs01_00085042 predicted 3943
10 SASI_Hs02_00361524 predicted 10800
11 SASI_Hs01_00085033 predicted 14742
12 SASI_Hs01_00085037 predicted 18492
13 SASI_Hs01_00085038 predicted 14384
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001076876 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00354864 predicted 1260
2 SASI_Rn02_00354865 predicted 8605
3 SASI_Rn02_00354866 predicted 12362
4 SASI_Rn02_00354867 predicted 13144
5 SASI_Rn02_00354868 predicted 18570
6 SASI_Rn02_00354869 predicted 13411
7 SASI_Rn02_00354870 predicted 6953
8 SASI_Rn02_00354871 predicted 16401
9 SASI_Rn02_00354872 predicted 18130
10 SASI_Rn02_00354873 predicted 17622
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_340807 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00391939 predicted 1258
2 SASI_Rn02_00391940 predicted 8592
3 SASI_Rn02_00391941 predicted 13138
4 SASI_Rn02_00391942 predicted 12877
5 SASI_Rn02_00391943 predicted 18563
6 SASI_Rn02_00391944 predicted 13398
7 SASI_Rn02_00391945 predicted 6951
8 SASI_Rn02_00391946 predicted 18124
9 SASI_Rn02_00391947 predicted 17622
10 SASI_Rn02_00391948 predicted 18403
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001003914 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00054666 predicted 203
2 SASI_Mm01_00054667 predicted 4398
3 SASI_Mm01_00054668 predicted 4233
4 SASI_Mm01_00054669 predicted 2760
5 SASI_Mm01_00054670 predicted 2291
6 SASI_Mm01_00054671 predicted 1133
7 SASI_Mm01_00054672 predicted 4391
8 SASI_Mm01_00054673 predicted 1767
9 SASI_Mm01_00054674 predicted 784
10 SASI_Mm01_00054675 predicted 1624
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001003914
OBSCN MISSION shRNA Bacterial Glycerol Stock
obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000110015    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003914.1-316s1c1
Sequence:CCGGCATTCCTTCTATGACGTTCAACTCGAGTTGAACGTCATAGAAGGAATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110019    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003914.1-4371s1c1
Sequence:CCGGACAGACAGACATTTGGGCTATCTCGAGATAGCCCAAATGTCTGTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110017    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003914.1-4493s1c1
Sequence:CCGGGTCGCTGCTATGCAGGATTATCTCGAGATAATCCTGCATAGCAGCGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110016    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003914.1-2005s1c1
Sequence:CCGGCAGGACAGTTGTAGAGGGAAACTCGAGTTTCCCTCTACAACTGTCCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110018    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003914.1-71s1c1
Sequence:CCGGGCCACCCACCACCCATAGTAACTCGAGTTACTATGGGTGGTGGGTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001003914
OBSCN MISSION shRNA shRNA Plasmid DNA
obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000110015    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003914.1-316s1c1
Sequence:CCGGCATTCCTTCTATGACGTTCAACTCGAGTTGAACGTCATAGAAGGAATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000110019    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003914.1-4371s1c1
Sequence:CCGGACAGACAGACATTTGGGCTATCTCGAGATAGCCCAAATGTCTGTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000110017    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003914.1-4493s1c1
Sequence:CCGGGTCGCTGCTATGCAGGATTATCTCGAGATAATCCTGCATAGCAGCGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000110016    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003914.1-2005s1c1
Sequence:CCGGCAGGACAGTTGTAGAGGGAAACTCGAGTTTCCCTCTACAACTGTCCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000110018    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003914.1-71s1c1
Sequence:CCGGGCCACCCACCACCCATAGTAACTCGAGTTACTATGGGTGGTGGGTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001003914
OBSCN MISSION shRNA Lentiviral Transduction Particles
obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000110015    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003914.1-316s1c1
Sequence:CCGGCATTCCTTCTATGACGTTCAACTCGAGTTGAACGTCATAGAAGGAATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110019    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003914.1-4371s1c1
Sequence:CCGGACAGACAGACATTTGGGCTATCTCGAGATAGCCCAAATGTCTGTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110017    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003914.1-4493s1c1
Sequence:CCGGGTCGCTGCTATGCAGGATTATCTCGAGATAATCCTGCATAGCAGCGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110016    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003914.1-2005s1c1
Sequence:CCGGCAGGACAGTTGTAGAGGGAAACTCGAGTTTCCCTCTACAACTGTCCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110018    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003914.1-71s1c1
Sequence:CCGGGCCACCCACCACCCATAGTAACTCGAGTTACTATGGGTGGTGGGTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_052843
VALIDATED
OBSCN MISSION shRNA Bacterial Glycerol Stock
obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000021599    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_052843.1-20060s1c1
Sequence:CCGGCCTTCTTACCTCACTCAACTTCTCGAGAAGTTGAGTGAGGTAAGAAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021600    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052843.1-15939s1c1
Sequence:CCGGCCCAGATTATACTGGTTCAAACTCGAGTTTGAACCAGTATAATCTGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021602    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052843.1-6870s1c1
Sequence:CCGGGCAGGAGAGATCCAATTTGTACTCGAGTACAAATTGGATCTCTCCTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021601    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052843.1-11472s1c1
Sequence:CCGGCCTGCCAGATTCATAGAAGATCTCGAGATCTTCTATGAATCTGGCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021603    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052843.1-10680s1c1
Sequence:CCGGCCTGCCAGGTTCATAGAAGATCTCGAGATCTTCTATGAACCTGGCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200011    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052843.1-3103s1c1
Sequence:CCGGCGGAGGTGATGTGGTACAAAGCTCGAGCTTTGTACCACATCACCTCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199810    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052843.1-6488s1c1
Sequence:CCGGGCCAGAGGATAGTGGCCTTATCTCGAGATAAGGCCACTATCCTCTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199121    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_052843.1-20172s1c1
Sequence:CCGGCTCAGGACTGTGGACGAAGGACTCGAGTCCTTCGTCCACAGTCCTGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195337    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052843.1-15224s1c1
Sequence:CCGGCCGCGAAGATGAGCATTTCATCTCGAGATGAAATGCTCATCTTCGCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_052843
VALIDATED
OBSCN MISSION shRNA shRNA Plasmid DNA
obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000021599    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_052843.1-20060s1c1
Sequence:CCGGCCTTCTTACCTCACTCAACTTCTCGAGAAGTTGAGTGAGGTAAGAAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021600    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052843.1-15939s1c1
Sequence:CCGGCCCAGATTATACTGGTTCAAACTCGAGTTTGAACCAGTATAATCTGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021602    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052843.1-6870s1c1
Sequence:CCGGGCAGGAGAGATCCAATTTGTACTCGAGTACAAATTGGATCTCTCCTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021601    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052843.1-11472s1c1
Sequence:CCGGCCTGCCAGATTCATAGAAGATCTCGAGATCTTCTATGAATCTGGCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021603    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052843.1-10680s1c1
Sequence:CCGGCCTGCCAGGTTCATAGAAGATCTCGAGATCTTCTATGAACCTGGCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000200011    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052843.1-3103s1c1
Sequence:CCGGCGGAGGTGATGTGGTACAAAGCTCGAGCTTTGTACCACATCACCTCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199810    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052843.1-6488s1c1
Sequence:CCGGGCCAGAGGATAGTGGCCTTATCTCGAGATAAGGCCACTATCCTCTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199121    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_052843.1-20172s1c1
Sequence:CCGGCTCAGGACTGTGGACGAAGGACTCGAGTCCTTCGTCCACAGTCCTGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195337    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052843.1-15224s1c1
Sequence:CCGGCCGCGAAGATGAGCATTTCATCTCGAGATGAAATGCTCATCTTCGCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_052843
VALIDATED
OBSCN MISSION shRNA Lentiviral Transduction Particles
obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000021599    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_052843.1-20060s1c1
Sequence:CCGGCCTTCTTACCTCACTCAACTTCTCGAGAAGTTGAGTGAGGTAAGAAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021600    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052843.1-15939s1c1
Sequence:CCGGCCCAGATTATACTGGTTCAAACTCGAGTTTGAACCAGTATAATCTGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021602    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052843.1-6870s1c1
Sequence:CCGGGCAGGAGAGATCCAATTTGTACTCGAGTACAAATTGGATCTCTCCTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021601    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052843.1-11472s1c1
Sequence:CCGGCCTGCCAGATTCATAGAAGATCTCGAGATCTTCTATGAATCTGGCAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021603    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052843.1-10680s1c1
Sequence:CCGGCCTGCCAGGTTCATAGAAGATCTCGAGATCTTCTATGAACCTGGCAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200011    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052843.1-3103s1c1
Sequence:CCGGCGGAGGTGATGTGGTACAAAGCTCGAGCTTTGTACCACATCACCTCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199810    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052843.1-6488s1c1
Sequence:CCGGGCCAGAGGATAGTGGCCTTATCTCGAGATAAGGCCACTATCCTCTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199121    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_052843.1-20172s1c1
Sequence:CCGGCTCAGGACTGTGGACGAAGGACTCGAGTCCTTCGTCCACAGTCCTGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195337    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052843.1-15224s1c1
Sequence:CCGGCCGCGAAGATGAGCATTTCATCTCGAGATGAAATGCTCATCTTCGCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)