EMAIL THIS PAGE TO A FRIEND

OBSL1

obscurin-like 1

112 Gene Product Result for
UniProtKB ID: O75147, A4KVA5, Q96IW3
Gene ID:
Human(23363) Summary: Cytoskeletal adaptor proteins function in linking the internal cytoskeleton of cells to the cell membrane. This gene encodes a cytoskeletal adaptor protein, which is a member of the Unc-89/obscurin family. The protein contains multiple N- and C-terminal immunoglobulin (Ig)-like domains and a central fibronectin type 3 domain. Mutations in this gene cause 3M syndrome type 2. Alternatively spliced transcript variants encoding different isoforms have been found in this gene. [provided by RefSeq, Mar 2010]
Mouse(98733) obscurin-like 1
Rat(363259) obscurin-like 1
chicken(424198) obscurin-like 1
cow(511087) obscurin-like 1
domestic cat(101101658) obscurin-like 1
dog(488539) obscurin-like 1
naked mole-rat(101708980) obscurin-like 1
Domestic Rabbit(100328894) obscurin-like 1
sheep(101114594) obscurin-like 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015311 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015311 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015311 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_178884 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178884 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178884 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015311 Rosetta Predictions human pricing
XM_051017 Rosetta Predictions human pricing
XM_001062053 Rosetta Predictions rat pricing
XM_343599 Rosetta Predictions rat pricing
NM_178884 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015311 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00347554 predicted 3017
2 SASI_Hs02_00347555 predicted 1199
3 SASI_Hs02_00347556 predicted 5015
4 SASI_Hs02_00347557 predicted 2968
5 SASI_Hs02_00347558 predicted 2087
6 SASI_Hs02_00347559 predicted 5021
7 SASI_Hs02_00347560 predicted 1741
8 SASI_Hs02_00347561 predicted 2431
9 SASI_Hs02_00347562 predicted 1203
10 SASI_Hs02_00347563 predicted 3244
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_051017 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00286491 predicted 3359
2 SASI_Hs01_00286492 predicted 1545
3 SASI_Hs01_00286493 predicted 5348
4 SASI_Hs01_00286494 predicted 3311
5 SASI_Hs01_00286495 predicted 2427
6 SASI_Hs01_00286496 predicted 5368
7 SASI_Hs01_00286497 predicted 4620
8 SASI_Hs01_00286498 predicted 2080
9 SASI_Hs01_00286499 predicted 2774
10 SASI_Hs01_00286500 predicted 1549
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001062053 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00302214 predicted 4426
2 SASI_Rn02_00302215 predicted 4071
3 SASI_Rn02_00302216 predicted 2822
4 SASI_Rn02_00302217 predicted 2660
5 SASI_Rn02_00302218 predicted 3292
6 SASI_Rn02_00302219 predicted 1776
7 SASI_Rn02_00302220 predicted 1756
8 SASI_Rn02_00302221 predicted 4575
9 SASI_Rn02_00302222 predicted 3814
10 SASI_Rn02_00302223 predicted 2145
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_343599 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00396088 predicted 4426
2 SASI_Rn02_00396089 predicted 4071
3 SASI_Rn02_00396090 predicted 2824
4 SASI_Rn02_00396091 predicted 2659
5 SASI_Rn02_00396092 predicted 3285
6 SASI_Rn02_00396093 predicted 1773
7 SASI_Rn02_00396094 predicted 1758
8 SASI_Rn02_00396095 predicted 4580
9 SASI_Rn02_00396096 predicted 3811
10 SASI_Rn02_00396097 predicted 2149
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178884 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00349469 predicted 1375
2 SASI_Mm02_00349470 predicted 4463
3 SASI_Mm02_00349471 predicted 1643
4 SASI_Mm02_00349472 predicted 5391
5 SASI_Mm01_00031655 predicted 4110
6 SASI_Mm01_00031656 predicted 3412
7 SASI_Mm01_00031658 predicted 4182
8 SASI_Mm01_00031660 predicted 2888
9 SASI_Mm01_00031661 predicted 1747
10 SASI_Mm01_00031662 predicted 4135
11 SASI_Mm01_00031653 predicted 2873
12 SASI_Mm01_00031654 predicted 697
13 SASI_Mm01_00031657 predicted 1538
14 SASI_Mm01_00031659 predicted 3029
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015311
OBSL1 MISSION shRNA Bacterial Glycerol Stock
obscurin-like 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000246291    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015311.1-2741s21c1
Sequence:CCGGTCTCCTCGTGGATCGTGTATCCTCGAGGATACACGATCCACGAGGAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246292    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015311.1-4835s21c1
Sequence:CCGGGTCACCGACTGGTACTCAATGCTCGAGCATTGAGTACCAGTCGGTGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246289    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015311.1-4286s21c1
Sequence:CCGGATGGTTCAAGCCGCATCTTAACTCGAGTTAAGATGCGGCTTGAACCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246293    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015311.1-960s21c1
Sequence:CCGGCTTCGTGCTCAAGGTGCTTTACTCGAGTAAAGCACCTTGAGCACGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246290    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015311.1-1529s21c1
Sequence:CCGGATGCTGGCGAGGTCACCTTTACTCGAGTAAAGGTGACCTCGCCAGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015311
OBSL1 MISSION shRNA shRNA Plasmid DNA
obscurin-like 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000246291    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015311.1-2741s21c1
Sequence:CCGGTCTCCTCGTGGATCGTGTATCCTCGAGGATACACGATCCACGAGGAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000246292    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015311.1-4835s21c1
Sequence:CCGGGTCACCGACTGGTACTCAATGCTCGAGCATTGAGTACCAGTCGGTGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000246289    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015311.1-4286s21c1
Sequence:CCGGATGGTTCAAGCCGCATCTTAACTCGAGTTAAGATGCGGCTTGAACCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000246293    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015311.1-960s21c1
Sequence:CCGGCTTCGTGCTCAAGGTGCTTTACTCGAGTAAAGCACCTTGAGCACGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000246290    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015311.1-1529s21c1
Sequence:CCGGATGCTGGCGAGGTCACCTTTACTCGAGTAAAGGTGACCTCGCCAGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015311
OBSL1 MISSION shRNA Lentiviral Transduction Particles
obscurin-like 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000246291    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015311.1-2741s21c1
Sequence:CCGGTCTCCTCGTGGATCGTGTATCCTCGAGGATACACGATCCACGAGGAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246292    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015311.1-4835s21c1
Sequence:CCGGGTCACCGACTGGTACTCAATGCTCGAGCATTGAGTACCAGTCGGTGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246289    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015311.1-4286s21c1
Sequence:CCGGATGGTTCAAGCCGCATCTTAACTCGAGTTAAGATGCGGCTTGAACCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246293    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015311.1-960s21c1
Sequence:CCGGCTTCGTGCTCAAGGTGCTTTACTCGAGTAAAGCACCTTGAGCACGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246290    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015311.1-1529s21c1
Sequence:CCGGATGCTGGCGAGGTCACCTTTACTCGAGTAAAGGTGACCTCGCCAGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178884
VALIDATED
OBSL1 MISSION shRNA Bacterial Glycerol Stock
obscurin-like 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000120497    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_178884.2-3880s1c1
Sequence:CCGGCCCAATCTTCTCCTACTTCATCTCGAGATGAAGTAGGAGAAGATTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120500    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178884.2-3354s1c1
Sequence:CCGGCAGTTGGAAATGGTCCAGAATCTCGAGATTCTGGACCATTTCCAACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120499    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178884.2-2679s1c1
Sequence:CCGGCGATCCCTGGATTTGCAGTTTCTCGAGAAACTGCAAATCCAGGGATCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120498    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178884.2-1768s1c1
Sequence:CCGGGCGGTGAATTTGAGTGCAGAACTCGAGTTCTGCACTCAAATTCACCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120501    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_178884.2-3138s1c1
Sequence:CCGGACAGGTGTCTACACTTGCCAACTCGAGTTGGCAAGTGTAGACACCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178884
VALIDATED
OBSL1 MISSION shRNA shRNA Plasmid DNA
obscurin-like 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000120497    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_178884.2-3880s1c1
Sequence:CCGGCCCAATCTTCTCCTACTTCATCTCGAGATGAAGTAGGAGAAGATTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000120500    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178884.2-3354s1c1
Sequence:CCGGCAGTTGGAAATGGTCCAGAATCTCGAGATTCTGGACCATTTCCAACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000120499    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178884.2-2679s1c1
Sequence:CCGGCGATCCCTGGATTTGCAGTTTCTCGAGAAACTGCAAATCCAGGGATCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000120498    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178884.2-1768s1c1
Sequence:CCGGGCGGTGAATTTGAGTGCAGAACTCGAGTTCTGCACTCAAATTCACCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000120501    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_178884.2-3138s1c1
Sequence:CCGGACAGGTGTCTACACTTGCCAACTCGAGTTGGCAAGTGTAGACACCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178884
VALIDATED
OBSL1 MISSION shRNA Lentiviral Transduction Particles
obscurin-like 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000120497    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_178884.2-3880s1c1
Sequence:CCGGCCCAATCTTCTCCTACTTCATCTCGAGATGAAGTAGGAGAAGATTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120500    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178884.2-3354s1c1
Sequence:CCGGCAGTTGGAAATGGTCCAGAATCTCGAGATTCTGGACCATTTCCAACTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120499    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178884.2-2679s1c1
Sequence:CCGGCGATCCCTGGATTTGCAGTTTCTCGAGAAACTGCAAATCCAGGGATCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120498    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178884.2-1768s1c1
Sequence:CCGGGCGGTGAATTTGAGTGCAGAACTCGAGTTCTGCACTCAAATTCACCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120501    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_178884.2-3138s1c1
Sequence:CCGGACAGGTGTCTACACTTGCCAACTCGAGTTGGCAAGTGTAGACACCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)