EMAIL THIS PAGE TO A FRIEND

OCLM

oculomedin

16 Gene Product Result for
Synonyms: TISR
Species: Human OCLM(10896)
UniProtKB ID: Q9Y5M6, Q4G0F9
Gene ID:
Human(10896) Summary: The protein encoded by this gene is induced by cyclic mechanical stretching in trabecular cells of the eye and it is also expressed in retina. This protein may play a role in trabecular meshwork function and the development of glaucoma. [provided by RefSeq, Jul 2008]
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_022375 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022375 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022375 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_022375 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022375 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00098897 predicted 522
2 SASI_Hs02_00355681 predicted 517
3 SASI_Hs01_00098898 predicted 551
4 SASI_Hs01_00098899 predicted 515
5 SASI_Hs02_00355682 predicted 485
6 SASI_Hs01_00098902 predicted 549
7 SASI_Hs01_00098903 predicted 501
8 SASI_Hs01_00098904 predicted 486
9 SASI_Hs02_00355683 predicted 480
10 SASI_Hs01_00098905 predicted 562
11 SASI_Hs01_00098900 predicted 561
12 SASI_Hs01_00098901 predicted 524
13 SASI_Hs01_00098906 predicted 477
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022375
OCLM MISSION shRNA Bacterial Glycerol Stock
oculomedin
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000432101    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022375.3-616s21c1
Sequence:CCGGTGCTGATGTTCAATTAGTAAACTCGAGTTTACTAATTGAACATCAGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417273    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022375.3-498s21c1
Sequence:CCGGGTTAAAGATTTACCTTAGCAGCTCGAGCTGCTAAGGTAAATCTTTAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429503    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022375.3-699s21c1
Sequence:CCGGATGTTAAAGCCTAATCCTAAACTCGAGTTTAGGATTAGGCTTTAACATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420445    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022375.3-520s21c1
Sequence:CCGGCACATTAGTATACTCTTCTATCTCGAGATAGAAGAGTATACTAATGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146845    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022375.2-652s1c1
Sequence:CCGGCAGCAGTTGTACTGTTTGTATCTCGAGATACAAACAGTACAACTGCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147230    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022375.2-504s1c1
Sequence:CCGGGATTTACCTTAGCAGACACATCTCGAGATGTGTCTGCTAAGGTAAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147935    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022375.2-654s1c1
Sequence:CCGGGCAGTTGTACTGTTTGTATGTCTCGAGACATACAAACAGTACAACTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147967    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022375.2-573s1c1
Sequence:CCGGGCTATCCTGGTATTCTTTCATCTCGAGATGAAAGAATACCAGGATAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148060    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022375.2-558s1c1
Sequence:CCGGGAGTGGTATTATATGGCTATCCTCGAGGATAGCCATATAATACCACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150219    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022375.2-560s1c1
Sequence:CCGGGTGGTATTATATGGCTATCCTCTCGAGAGGATAGCCATATAATACCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022375
OCLM MISSION shRNA shRNA Plasmid DNA
oculomedin
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000432101    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022375.3-616s21c1
Sequence:CCGGTGCTGATGTTCAATTAGTAAACTCGAGTTTACTAATTGAACATCAGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417273    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022375.3-498s21c1
Sequence:CCGGGTTAAAGATTTACCTTAGCAGCTCGAGCTGCTAAGGTAAATCTTTAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429503    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022375.3-699s21c1
Sequence:CCGGATGTTAAAGCCTAATCCTAAACTCGAGTTTAGGATTAGGCTTTAACATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420445    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022375.3-520s21c1
Sequence:CCGGCACATTAGTATACTCTTCTATCTCGAGATAGAAGAGTATACTAATGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000146845    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022375.2-652s1c1
Sequence:CCGGCAGCAGTTGTACTGTTTGTATCTCGAGATACAAACAGTACAACTGCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147230    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022375.2-504s1c1
Sequence:CCGGGATTTACCTTAGCAGACACATCTCGAGATGTGTCTGCTAAGGTAAATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147935    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022375.2-654s1c1
Sequence:CCGGGCAGTTGTACTGTTTGTATGTCTCGAGACATACAAACAGTACAACTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147967    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022375.2-573s1c1
Sequence:CCGGGCTATCCTGGTATTCTTTCATCTCGAGATGAAAGAATACCAGGATAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148060    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022375.2-558s1c1
Sequence:CCGGGAGTGGTATTATATGGCTATCCTCGAGGATAGCCATATAATACCACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000150219    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022375.2-560s1c1
Sequence:CCGGGTGGTATTATATGGCTATCCTCTCGAGAGGATAGCCATATAATACCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022375
OCLM MISSION shRNA Lentiviral Transduction Particles
oculomedin
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000432101    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022375.3-616s21c1
Sequence:CCGGTGCTGATGTTCAATTAGTAAACTCGAGTTTACTAATTGAACATCAGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417273    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022375.3-498s21c1
Sequence:CCGGGTTAAAGATTTACCTTAGCAGCTCGAGCTGCTAAGGTAAATCTTTAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429503    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022375.3-699s21c1
Sequence:CCGGATGTTAAAGCCTAATCCTAAACTCGAGTTTAGGATTAGGCTTTAACATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420445    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022375.3-520s21c1
Sequence:CCGGCACATTAGTATACTCTTCTATCTCGAGATAGAAGAGTATACTAATGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146845    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022375.2-652s1c1
Sequence:CCGGCAGCAGTTGTACTGTTTGTATCTCGAGATACAAACAGTACAACTGCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147230    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022375.2-504s1c1
Sequence:CCGGGATTTACCTTAGCAGACACATCTCGAGATGTGTCTGCTAAGGTAAATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147935    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022375.2-654s1c1
Sequence:CCGGGCAGTTGTACTGTTTGTATGTCTCGAGACATACAAACAGTACAACTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147967    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022375.2-573s1c1
Sequence:CCGGGCTATCCTGGTATTCTTTCATCTCGAGATGAAAGAATACCAGGATAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148060    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022375.2-558s1c1
Sequence:CCGGGAGTGGTATTATATGGCTATCCTCGAGGATAGCCATATAATACCACTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150219    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022375.2-560s1c1
Sequence:CCGGGTGGTATTATATGGCTATCCTCTCGAGAGGATAGCCATATAATACCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)