EMAIL THIS PAGE TO A FRIEND

OCM2

oncomodulin 2

31 Gene Product Result for
Synonyms: OCM
UniProtKB ID: P0CE71, P32930, Q6ISI5, Q75MW0
Gene ID:
Human(4951) Summary: This gene is similar to the oncomodulin gene, a high-affinity calcium ion-binding protein that belongs to the superfamily of calmodulin proteins, also known as the EF-hand proteins. [provided by RefSeq, Jul 2008]
Rat(25503) oncomodulin 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1101048 Anti-OCM2 (21-35) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
immunofluorescence, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006188 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006188 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006188 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006188 Rosetta Predictions human pricing
NM_012995 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006188 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00030852 predicted 308
2 SASI_Hs01_00030854 predicted 346
3 SASI_Hs01_00030855 predicted 217
4 SASI_Hs01_00030856 predicted 260
5 SASI_Hs01_00030857 predicted 229
6 SASI_Hs01_00030858 predicted 305
7 SASI_Hs02_00341065 predicted 357
8 SASI_Hs01_00030860 predicted 259
9 SASI_Hs01_00030861 predicted 252
10 SASI_Hs02_00341066 predicted 233
11 SASI_Hs01_00030853 predicted 362
12 SASI_Hs01_00030859 predicted 366
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012995 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00051747 predicted 288
2 SASI_Rn02_00260638 predicted 365
3 SASI_Rn01_00051748 predicted 200
4 SASI_Rn01_00051749 predicted 252
5 SASI_Rn01_00051750 predicted 204
6 SASI_Rn01_00051752 predicted 341
7 SASI_Rn01_00051753 predicted 301
8 SASI_Rn02_00260639 predicted 306
9 SASI_Rn02_00260640 predicted 232
10 SASI_Rn01_00051755 predicted 199
11 SASI_Rn01_00051751 predicted 241
12 SASI_Rn01_00051754 predicted 259
13 SASI_Rn01_00051756 predicted 312
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006188
OCM2 MISSION shRNA Bacterial Glycerol Stock
oncomodulin 2
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000425398    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006188.3-54s21c1
Sequence:CCGGATGCCAAGACCCAGACACTTTCTCGAGAAAGTGTCTGGGTCTTGGCATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416549    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006188.3-367s21c1
Sequence:CCGGATCACCTGGAAGGATTCCAAACTCGAGTTTGGAATCCTTCCAGGTGATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005331    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006188.2-412s1c1
Sequence:CCGGCCCATCCCTACCTAATTTGTTCTCGAGAACAAATTAGGTAGGGATGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005334    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006188.2-309s1c1
Sequence:CCGGCCAGGAAATGGTGCATTCTTACTCGAGTAAGAATGCACCATTTCCTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005335    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006188.2-174s1c1
Sequence:CCGGCCTGGATGAAGAAGAGCTTAACTCGAGTTAAGCTCTTCTTCATCCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005333    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006188.2-121s1c1
Sequence:CCGGGCCAATCAGGTGAAGGATGTTCTCGAGAACATCCTTCACCTGATTGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005332    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006188.2-237s1c1
Sequence:CCGGCGAGTCAGAAACCAAGTCCTTCTCGAGAAGGACTTGGTTTCTGACTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006188
OCM2 MISSION shRNA shRNA Plasmid DNA
oncomodulin 2
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000425398    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006188.3-54s21c1
Sequence:CCGGATGCCAAGACCCAGACACTTTCTCGAGAAAGTGTCTGGGTCTTGGCATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416549    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006188.3-367s21c1
Sequence:CCGGATCACCTGGAAGGATTCCAAACTCGAGTTTGGAATCCTTCCAGGTGATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005331    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006188.2-412s1c1
Sequence:CCGGCCCATCCCTACCTAATTTGTTCTCGAGAACAAATTAGGTAGGGATGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005334    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006188.2-309s1c1
Sequence:CCGGCCAGGAAATGGTGCATTCTTACTCGAGTAAGAATGCACCATTTCCTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005335    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006188.2-174s1c1
Sequence:CCGGCCTGGATGAAGAAGAGCTTAACTCGAGTTAAGCTCTTCTTCATCCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005333    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006188.2-121s1c1
Sequence:CCGGGCCAATCAGGTGAAGGATGTTCTCGAGAACATCCTTCACCTGATTGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005332    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006188.2-237s1c1
Sequence:CCGGCGAGTCAGAAACCAAGTCCTTCTCGAGAAGGACTTGGTTTCTGACTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006188
OCM2 MISSION shRNA Lentiviral Transduction Particles
oncomodulin 2
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000425398    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006188.3-54s21c1
Sequence:CCGGATGCCAAGACCCAGACACTTTCTCGAGAAAGTGTCTGGGTCTTGGCATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416549    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006188.3-367s21c1
Sequence:CCGGATCACCTGGAAGGATTCCAAACTCGAGTTTGGAATCCTTCCAGGTGATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005331    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006188.2-412s1c1
Sequence:CCGGCCCATCCCTACCTAATTTGTTCTCGAGAACAAATTAGGTAGGGATGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005334    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006188.2-309s1c1
Sequence:CCGGCCAGGAAATGGTGCATTCTTACTCGAGTAAGAATGCACCATTTCCTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005335    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006188.2-174s1c1
Sequence:CCGGCCTGGATGAAGAAGAGCTTAACTCGAGTTAAGCTCTTCTTCATCCAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005333    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006188.2-121s1c1
Sequence:CCGGGCCAATCAGGTGAAGGATGTTCTCGAGAACATCCTTCACCTGATTGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005332    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006188.2-237s1c1
Sequence:CCGGCGAGTCAGAAACCAAGTCCTTCTCGAGAAGGACTTGGTTTCTGACTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)