EMAIL THIS PAGE TO A FRIEND

OCM

oncomodulin

53 Gene Product Result for
Synonyms: OCM1 OM ONCM
Species: Human OCM(654231), Mouse Ocm(18261), chicken OCM(386586), dog OCM(489870), domestic guinea pig Ocm(100135585)
UniProtKB ID: P0CE72, B9EJH7, P32930, Q6ISI5, Q75MW0
Gene ID:
Human(654231) Summary: Oncomodulin is a high-affinity calcium ion-binding protein. It belongs to the superfamily of calmodulin proteins, also known as the EF-hand proteins. Oncomodulin is an oncodevelopmental protein found in early embryonic cells in the placenta and also in tumors. [provided by RefSeq, Jul 2008]
Mouse(18261) oncomodulin
chicken(386586) oncomodulin 2
dog(489870) oncomodulin 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_033039 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_033039 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_033039 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001097622 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001097622 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001097622 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001097622 Rosetta Predictions human pricing
XM_928782 Rosetta Predictions human pricing
NM_033039 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001097622 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00318470 predicted 401
2 SASI_Hs02_00318471 predicted 439
3 SASI_Hs02_00318472 predicted 385
4 SASI_Hs02_00318473 predicted 211
5 SASI_Hs02_00318474 predicted 211
6 SASI_Hs02_00318475 predicted 301
7 SASI_Hs02_00318476 predicted 311
8 SASI_Hs02_00318477 predicted 446
9 SASI_Hs02_00318478 predicted 396
10 SASI_Hs02_00318479 predicted 345
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_928782 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00251639 predicted 311
2 SASI_Hs01_00251640 predicted 350
3 SASI_Hs01_00251641 predicted 301
4 SASI_Hs01_00251642 predicted 368
5 SASI_Hs01_00251643 predicted 265
6 SASI_Hs01_00251644 predicted 309
7 SASI_Hs01_00251645 predicted 363
8 SASI_Hs01_00251646 predicted 307
9 SASI_Hs01_00251647 predicted 299
10 SASI_Hs01_00251648 predicted 296
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033039 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00063544 predicted 438
2 SASI_Mm01_00063543 predicted 261
3 SASI_Mm01_00063547 predicted 432
4 SASI_Mm01_00063550 predicted 432
5 SASI_Mm01_00063545 predicted 249
6 SASI_Mm01_00063548 predicted 446
7 SASI_Mm01_00063551 predicted 356
8 SASI_Mm01_00063552 predicted 308
9 SASI_Mm02_00337268 predicted 261
10 SASI_Mm02_00337269 predicted 213
11 SASI_Mm01_00063546 predicted 429
12 SASI_Mm01_00063549 predicted 489
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033039
OCM MISSION shRNA Bacterial Glycerol Stock
oncomodulin
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000104825    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033039.1-438s1c1
Sequence:CCGGCAGGAAATGGTGCATTCTTAACTCGAGTTAAGAATGCACCATTTCCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104826    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033039.1-292s1c1
Sequence:CCGGCAGAGTGGATACCTGGATGAACTCGAGTTCATCCAGGTATCCACTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104827    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033039.1-394s1c1
Sequence:CCGGGCAGCGGACAACGATGGAGATCTCGAGATCTCCATCGTTGTCCGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104828    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033039.1-249s1c1
Sequence:CCGGTGCCAGCCAATTGAAGGATATCTCGAGATATCCTTCAATTGGCTGGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104829    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033039.1-252s1c1
Sequence:CCGGCAGCCAATTGAAGGATATCTTCTCGAGAAGATATCCTTCAATTGGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033039
OCM MISSION shRNA shRNA Plasmid DNA
oncomodulin
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000104825    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033039.1-438s1c1
Sequence:CCGGCAGGAAATGGTGCATTCTTAACTCGAGTTAAGAATGCACCATTTCCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104826    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033039.1-292s1c1
Sequence:CCGGCAGAGTGGATACCTGGATGAACTCGAGTTCATCCAGGTATCCACTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104827    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033039.1-394s1c1
Sequence:CCGGGCAGCGGACAACGATGGAGATCTCGAGATCTCCATCGTTGTCCGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104828    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033039.1-249s1c1
Sequence:CCGGTGCCAGCCAATTGAAGGATATCTCGAGATATCCTTCAATTGGCTGGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104829    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033039.1-252s1c1
Sequence:CCGGCAGCCAATTGAAGGATATCTTCTCGAGAAGATATCCTTCAATTGGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033039
OCM MISSION shRNA Lentiviral Transduction Particles
oncomodulin
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000104825    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033039.1-438s1c1
Sequence:CCGGCAGGAAATGGTGCATTCTTAACTCGAGTTAAGAATGCACCATTTCCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104826    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033039.1-292s1c1
Sequence:CCGGCAGAGTGGATACCTGGATGAACTCGAGTTCATCCAGGTATCCACTCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104827    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033039.1-394s1c1
Sequence:CCGGGCAGCGGACAACGATGGAGATCTCGAGATCTCCATCGTTGTCCGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104828    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033039.1-249s1c1
Sequence:CCGGTGCCAGCCAATTGAAGGATATCTCGAGATATCCTTCAATTGGCTGGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104829    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033039.1-252s1c1
Sequence:CCGGCAGCCAATTGAAGGATATCTTCTCGAGAAGATATCCTTCAATTGGCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001097622
OCM MISSION shRNA Bacterial Glycerol Stock
oncomodulin
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000262298    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001097622.1-501s21c1
Sequence:CCGGACATCCCATCCCTACCTAATTCTCGAGAATTAGGTAGGGATGGGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000282171    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001097622.1-320s21c1
Sequence:CCGGAGAACTGACCGAGTCAGAAACCTCGAGGTTTCTGACTCGGTCAGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262297    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001097622.1-199s21c1
Sequence:CCGGTCTCCAAGATGTCAGCCAATCCTCGAGGATTGGCTGACATCTTGGAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000282173    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001097622.1-402s21c1
Sequence:CCGGCAGGAAATGGTGCATTCTTAACTCGAGTTAAGAATGCACCATTTCCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262299    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001097622.1-267s21c1
Sequence:CCGGCTGGATGAAGAAGAGCTTAAGCTCGAGCTTAAGCTCTTCTTCATCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001097622
OCM MISSION shRNA shRNA Plasmid DNA
oncomodulin
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000262298    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001097622.1-501s21c1
Sequence:CCGGACATCCCATCCCTACCTAATTCTCGAGAATTAGGTAGGGATGGGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000282171    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001097622.1-320s21c1
Sequence:CCGGAGAACTGACCGAGTCAGAAACCTCGAGGTTTCTGACTCGGTCAGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000262297    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001097622.1-199s21c1
Sequence:CCGGTCTCCAAGATGTCAGCCAATCCTCGAGGATTGGCTGACATCTTGGAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000282173    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001097622.1-402s21c1
Sequence:CCGGCAGGAAATGGTGCATTCTTAACTCGAGTTAAGAATGCACCATTTCCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000262299    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001097622.1-267s21c1
Sequence:CCGGCTGGATGAAGAAGAGCTTAAGCTCGAGCTTAAGCTCTTCTTCATCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001097622
OCM MISSION shRNA Lentiviral Transduction Particles
oncomodulin
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000262298    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001097622.1-501s21c1
Sequence:CCGGACATCCCATCCCTACCTAATTCTCGAGAATTAGGTAGGGATGGGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000282171    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001097622.1-320s21c1
Sequence:CCGGAGAACTGACCGAGTCAGAAACCTCGAGGTTTCTGACTCGGTCAGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262297    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001097622.1-199s21c1
Sequence:CCGGTCTCCAAGATGTCAGCCAATCCTCGAGGATTGGCTGACATCTTGGAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000282173    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001097622.1-402s21c1
Sequence:CCGGCAGGAAATGGTGCATTCTTAACTCGAGTTAAGAATGCACCATTTCCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262299    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001097622.1-267s21c1
Sequence:CCGGCTGGATGAAGAAGAGCTTAAGCTCGAGCTTAAGCTCTTCTTCATCCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)