EMAIL THIS PAGE TO A FRIEND

ODAM

odontogenic, ameloblast asssociated

61 Gene Product Result for
Synonyms: APIN
UniProtKB ID: A1E959, Q8WWE5, Q9NWZ9
Gene ID:
Mouse(69592) odontogenic, ameloblast asssociated
Rat(641555) odontogenic, ameloblast asssociated
Zebrafish(100270760) odontogenic, ameloblast asssociated
domestic cat(101097806) odontogenic, ameloblast asssociated
cow(613976) odontogenic, ameloblast asssociated
dog(611755) odontogenic, ameloblast asssociated
sheep(101120578) odontogenic, ameloblast asssociated
domestic guinea pig(100733113) odontogenic, ameloblast asssociated
naked mole-rat(101698251) odontogenic, ameloblast asssociated
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1409472 Anti-ODAM antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_027128 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027128 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027128 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_017855 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017855 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017855 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU085241 MISSION® esiRNA esiRNA human ODAM (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017855 Rosetta Predictions human pricing
NM_001044274 Rosetta Predictions rat pricing
NM_027128 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017855 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00350753 predicted 289
2 SASI_Hs02_00350754 predicted 432
3 SASI_Hs02_00350755 predicted 537
4 SASI_Hs01_00176952 predicted 771
5 SASI_Hs02_00350756 predicted 576
6 SASI_Hs01_00176956 predicted 849
7 SASI_Hs02_00350757 predicted 268
8 SASI_Hs01_00176957 predicted 709
9 SASI_Hs02_00350758 predicted 656
10 SASI_Hs02_00350759 predicted 270
11 SASI_Hs01_00176950 predicted 439
12 SASI_Hs01_00176951 predicted 618
13 SASI_Hs01_00176953 predicted 472
14 SASI_Hs01_00176954 predicted 315
15 SASI_Hs01_00176955 predicted 395
16 SASI_Hs01_00176958 predicted 575
17 SASI_Hs01_00176959 predicted 655
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001044274 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00205414 predicted 876
2 SASI_Rn02_00205415 predicted 571
3 SASI_Rn02_00205416 predicted 853
4 SASI_Rn02_00205417 predicted 871
5 SASI_Rn02_00205418 predicted 423
6 SASI_Rn02_00205419 predicted 743
7 SASI_Rn02_00205420 predicted 642
8 SASI_Rn02_00205421 predicted 737
9 SASI_Rn02_00205422 predicted 821
10 SASI_Rn02_00205423 predicted 734
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027128 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00331600 predicted 258
2 SASI_Mm02_00331601 predicted 521
3 SASI_Mm02_00331602 predicted 528
4 SASI_Mm02_00331603 predicted 391
5 SASI_Mm02_00331604 predicted 382
6 SASI_Mm02_00331605 predicted 425
7 SASI_Mm02_00331606 predicted 369
8 SASI_Mm02_00331607 predicted 426
9 SASI_Mm02_00331608 predicted 504
10 SASI_Mm02_00331609 predicted 368
11 SASI_Mm01_00143930 predicted 790
12 SASI_Mm01_00143931 predicted 535
13 SASI_Mm01_00143932 predicted 752
14 SASI_Mm01_00143933 predicted 491
15 SASI_Mm01_00143934 predicted 714
16 SASI_Mm01_00143935 predicted 745
17 SASI_Mm01_00143936 predicted 407
18 SASI_Mm01_00143937 predicted 541
19 SASI_Mm01_00143938 predicted 620
20 SASI_Mm01_00143939 predicted 829
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027128
ODAM MISSION shRNA Bacterial Glycerol Stock
odontogenic, ameloblast asssociated
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000195983    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027128.1-256s1c1
Sequence:CCGGCAATTTGGATTCGCACCACCACTCGAGTGGTGGTGCGAATCCAAATTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183755    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027128.1-398s1c1
Sequence:CCGGCAATCAGCTTTAAGCATGATACTCGAGTATCATGCTTAAAGCTGATTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183208    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_027128.1-899s1c1
Sequence:CCGGGCAATGATAATCTTCCAAACACTCGAGTGTTTGGAAGATTATCATTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180736    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027128.1-505s1c1
Sequence:CCGGGAACAGAAGGTCAAGACTGATCTCGAGATCAGTCTTGACCTTCTGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179269    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027128.1-232s1c1
Sequence:CCGGGAGGAACAGATACCTTTCTATCTCGAGATAGAAAGGTATCTGTTCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179450    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027128.1-394s1c1
Sequence:CCGGGAACCAATCAGCTTTAAGCATCTCGAGATGCTTAAAGCTGATTGGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183341    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027128.1-824s1c1
Sequence:CCGGGCACTAGAAATAAAGCACATTCTCGAGAATGTGCTTTATTTCTAGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216271    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027128.2-410s1c1
Sequence:CCGGCAAAGTACCTCAAGATCAAACCTCGAGGTTTGATCTTGAGGTACTTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027128
ODAM MISSION shRNA shRNA Plasmid DNA
odontogenic, ameloblast asssociated
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000195983    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027128.1-256s1c1
Sequence:CCGGCAATTTGGATTCGCACCACCACTCGAGTGGTGGTGCGAATCCAAATTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000183755    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027128.1-398s1c1
Sequence:CCGGCAATCAGCTTTAAGCATGATACTCGAGTATCATGCTTAAAGCTGATTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000183208    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_027128.1-899s1c1
Sequence:CCGGGCAATGATAATCTTCCAAACACTCGAGTGTTTGGAAGATTATCATTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000180736    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027128.1-505s1c1
Sequence:CCGGGAACAGAAGGTCAAGACTGATCTCGAGATCAGTCTTGACCTTCTGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000179269    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027128.1-232s1c1
Sequence:CCGGGAGGAACAGATACCTTTCTATCTCGAGATAGAAAGGTATCTGTTCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000179450    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027128.1-394s1c1
Sequence:CCGGGAACCAATCAGCTTTAAGCATCTCGAGATGCTTAAAGCTGATTGGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000183341    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027128.1-824s1c1
Sequence:CCGGGCACTAGAAATAAAGCACATTCTCGAGAATGTGCTTTATTTCTAGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000216271    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027128.2-410s1c1
Sequence:CCGGCAAAGTACCTCAAGATCAAACCTCGAGGTTTGATCTTGAGGTACTTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027128
ODAM MISSION shRNA Lentiviral Transduction Particles
odontogenic, ameloblast asssociated
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000195983    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027128.1-256s1c1
Sequence:CCGGCAATTTGGATTCGCACCACCACTCGAGTGGTGGTGCGAATCCAAATTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183755    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027128.1-398s1c1
Sequence:CCGGCAATCAGCTTTAAGCATGATACTCGAGTATCATGCTTAAAGCTGATTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183208    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_027128.1-899s1c1
Sequence:CCGGGCAATGATAATCTTCCAAACACTCGAGTGTTTGGAAGATTATCATTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180736    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027128.1-505s1c1
Sequence:CCGGGAACAGAAGGTCAAGACTGATCTCGAGATCAGTCTTGACCTTCTGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179269    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027128.1-232s1c1
Sequence:CCGGGAGGAACAGATACCTTTCTATCTCGAGATAGAAAGGTATCTGTTCCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179450    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027128.1-394s1c1
Sequence:CCGGGAACCAATCAGCTTTAAGCATCTCGAGATGCTTAAAGCTGATTGGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183341    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027128.1-824s1c1
Sequence:CCGGGCACTAGAAATAAAGCACATTCTCGAGAATGTGCTTTATTTCTAGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216271    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027128.2-410s1c1
Sequence:CCGGCAAAGTACCTCAAGATCAAACCTCGAGGTTTGATCTTGAGGTACTTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017855
ODAM MISSION shRNA Bacterial Glycerol Stock
odontogenic, ameloblast asssociated
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000143987    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017855.2-310s1c1
Sequence:CCGGCGATCAACTTTAGACATGACACTCGAGTGTCATGTCTAAAGTTGATCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141590    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017855.2-186s1c1
Sequence:CCGGCAACTAGCAGAACCTGCTATACTCGAGTATAGCAGGTTCTGCTAGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140263    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017855.2-134s1c1
Sequence:CCGGGCAACAGTATGAGGAGCAGATCTCGAGATCTGCTCCTCATACTGTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140907    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017855.2-90s1c1
Sequence:CCGGCAACCTCAGCAAACAGTTCCACTCGAGTGGAACTGTTTGCTGAGGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140965    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017855.2-59s1c1
Sequence:CCGGCTATCCAGTTTACATGGTCCTCTCGAGAGGACCATGTAAACTGGATAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141624    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017855.2-255s1c1
Sequence:CCGGCCTGAAATTGCTGTGATGTCACTCGAGTGACATCACAGCAATTTCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141801    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017855.2-471s1c1
Sequence:CCGGGCCCTGATCATTCAGACATTTCTCGAGAAATGTCTGAATGATCAGGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141960    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017855.2-36s1c1
Sequence:CCGGGAGCAAGGACAGATGTTTCAACTCGAGTTGAAACATCTGTCCTTGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141896    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017855.2-144s1c1
Sequence:CCGGGAGGAGCAGATACCATTCTATCTCGAGATAGAATGGTATCTGCTCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144979    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017855.2-507s1c1
Sequence:CCGGGCCATGCCTTGGATATAATTTCTCGAGAAATTATATCCAAGGCATGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144882    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017855.2-38s1c1
Sequence:CCGGGCAAGGACAGATGTTTCAATACTCGAGTATTGAAACATCTGTCCTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017855
ODAM MISSION shRNA shRNA Plasmid DNA
odontogenic, ameloblast asssociated
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000143987    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017855.2-310s1c1
Sequence:CCGGCGATCAACTTTAGACATGACACTCGAGTGTCATGTCTAAAGTTGATCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141590    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017855.2-186s1c1
Sequence:CCGGCAACTAGCAGAACCTGCTATACTCGAGTATAGCAGGTTCTGCTAGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140263    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017855.2-134s1c1
Sequence:CCGGGCAACAGTATGAGGAGCAGATCTCGAGATCTGCTCCTCATACTGTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140907    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017855.2-90s1c1
Sequence:CCGGCAACCTCAGCAAACAGTTCCACTCGAGTGGAACTGTTTGCTGAGGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140965    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017855.2-59s1c1
Sequence:CCGGCTATCCAGTTTACATGGTCCTCTCGAGAGGACCATGTAAACTGGATAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141624    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017855.2-255s1c1
Sequence:CCGGCCTGAAATTGCTGTGATGTCACTCGAGTGACATCACAGCAATTTCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141801    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017855.2-471s1c1
Sequence:CCGGGCCCTGATCATTCAGACATTTCTCGAGAAATGTCTGAATGATCAGGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141960    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017855.2-36s1c1
Sequence:CCGGGAGCAAGGACAGATGTTTCAACTCGAGTTGAAACATCTGTCCTTGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141896    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017855.2-144s1c1
Sequence:CCGGGAGGAGCAGATACCATTCTATCTCGAGATAGAATGGTATCTGCTCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144979    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017855.2-507s1c1
Sequence:CCGGGCCATGCCTTGGATATAATTTCTCGAGAAATTATATCCAAGGCATGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144882    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017855.2-38s1c1
Sequence:CCGGGCAAGGACAGATGTTTCAATACTCGAGTATTGAAACATCTGTCCTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017855
ODAM MISSION shRNA Lentiviral Transduction Particles
odontogenic, ameloblast asssociated
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000143987    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017855.2-310s1c1
Sequence:CCGGCGATCAACTTTAGACATGACACTCGAGTGTCATGTCTAAAGTTGATCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141590    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017855.2-186s1c1
Sequence:CCGGCAACTAGCAGAACCTGCTATACTCGAGTATAGCAGGTTCTGCTAGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140263    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017855.2-134s1c1
Sequence:CCGGGCAACAGTATGAGGAGCAGATCTCGAGATCTGCTCCTCATACTGTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140907    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017855.2-90s1c1
Sequence:CCGGCAACCTCAGCAAACAGTTCCACTCGAGTGGAACTGTTTGCTGAGGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140965    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017855.2-59s1c1
Sequence:CCGGCTATCCAGTTTACATGGTCCTCTCGAGAGGACCATGTAAACTGGATAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141624    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017855.2-255s1c1
Sequence:CCGGCCTGAAATTGCTGTGATGTCACTCGAGTGACATCACAGCAATTTCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141801    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017855.2-471s1c1
Sequence:CCGGGCCCTGATCATTCAGACATTTCTCGAGAAATGTCTGAATGATCAGGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141960    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017855.2-36s1c1
Sequence:CCGGGAGCAAGGACAGATGTTTCAACTCGAGTTGAAACATCTGTCCTTGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141896    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017855.2-144s1c1
Sequence:CCGGGAGGAGCAGATACCATTCTATCTCGAGATAGAATGGTATCTGCTCCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144979    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017855.2-507s1c1
Sequence:CCGGGCCATGCCTTGGATATAATTTCTCGAGAAATTATATCCAAGGCATGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144882    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017855.2-38s1c1
Sequence:CCGGGCAAGGACAGATGTTTCAATACTCGAGTATTGAAACATCTGTCCTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)